günstigster preis für liv 52

Ein hochbegabtes Kind mit einem Prozentrang von >10% (z.B. 11%) im Mathetest kann nicht mehr als rechenschwach gelten, obwohl durch die immer noch sehr geringe mathematische Leistung auch psychische Probleme drohen.

Von deiner Geburt bis zu deinem 18. Lebensjahr bist du vor deutschen Gesetzen ein Kind bzw. ein Jugendlicher.

Das wohl bekannteste Gesetz für Kinder und Jugendliche ist das Jugendschutzgesetz (JuSchG).

Es regelt unter anderem, in welchem Alter du dich, wo und wie lange in der Öffentlichkeit aufhalten darfst.

Daneben gibt es eine ganze Reihe anderer Gesetze, die dich schützen, versorgen und absichern. Solche Gesetze gibt es nicht überall auf der Welt.

Und auch in Deutschland gibt es noch eine Menge zu tun, um das Leben für Kinder besser zu machen.

Ein erster Schritt auf einem langen Weg

Am 20. November 1989 haben die Vereinten Nationen ein gemeinsames Abkommen über Kinderrechte beschlossen. Darin wurde festgelegt, wie alle Kinder dieser Erde geschützt und gefördert werden sollen. Bis zum Jahr 2002 haben 192 Staaten die sogenannte Kinderrechtskonvention unterzeichnet und versprochen, in ihren Ländern die Zukunft für und mit Kindern besser zu machen.

Dies kann die Versorgung mit frischem Trinkwasser, Medikamenten und Schulen bedeuten oder wie es in Deutschland gefordert wird, die Kinderrechte im Grundgesetz festzuschreiben.

Wir haben die 54 Artikel der Kinderrechtskonvention in vier große Bereiche unterteilt:

1. Alle Kinder haben das Recht auf Leben.
Alle Kinder dieser Erde haben die gleichen Rechte. Die Regierungen der Länder müssen Bedingungen für die Sicherheit und Versorgung aller Kinder schaffen und ihre persönlichen Rechte wahren. Dazu gehören z. B. Hilfen zum Leben und zur Gesunderhaltung, das Recht bei seinen Eltern zu leben, das Briefgeheimnis oder das Recht auf freie Zeit zum Spielen. Kinder mit körperlichen und/oder geistigen Einschränkungen benötigen besondere Förderung und Hilfen.

2. Alle Kinder haben das Recht, sich ihren Fähigkeiten nach zu entwickeln.
Die Regierungen müssen für alle Kinder Möglichkeiten und Einrichtungen schaffen, in denen sie sich Fähigkeiten und Wissen aneignen können, um ihre Zukunft selbst zu gestalten. Dazu gehören z. B. Kindergärten, Schulen, Sonderschulen, aber auch Bücher, Filme, Radio, Webseiten und Zeitungen für Kinder.
Erst mit der Durchsetzung des Bildungsrechts, der Meinungs- und der Glaubensfreiheit, werden aus Kindern unabhängige und kritische Erwachsene.

3. Alle Kinder haben das Recht, geschützt zu werden.
Kinder können sich nicht selbst schützen. Daher sind die Regierungen aufgefordert, Bedingungen zu schaffen, die Leib und Leben aller Kinder schützen. Dazu gehört z. B. der Schutz vor Ausbeutung und Gewalt, Misshandlung oder abhängig machenden Dingen wie das Rauchen oder Onlinespielen.

4. Alle Kinder haben ein Recht auf Mitsprache.
Kinder haben das Recht, zu sagen, was sie wollen. Das gilt innerhalb der Familie ebenso wie außerhalb. Deshalb sollen die Länder Möglichkeiten schaffen, den Vorschlägen und Forderungen von Kindern durch Mitsprache in Schulen, Vereinen, Gemeinden, Ratsversammlungen und Parlamenten Nachdruck zu verleihen.

Für die World Health Organisation scheint das Problem der Videospielsucht nun so ernst zu sein, dass sie die "Gaming Disorder" als psychische Störung in die Neuauflage ihres Registers für Krankheiten aufnehmen will. Nicht alle Wissenschaftler halten das für eine gute Idee.

Von Mira Fricke

Realität und virtuelle Welten Warum Videospiele so real wie die Wirklichkeit sind

Computerspiele Der Boom der Battle-Royale-Games

Computerspiele Das passende Adventure zum postfaktischen Zeitalter

Computerspiele Die Entwicklung der Games

Kunst und Computerspiele Pixelwelt statt Hyperrealismus

Tagung zum Kulturgut Computerspiel "Computerspiele sind in der Mitte der Gesellschaft angekommen"

Können Videospiele süchtig machen? Dass es Menschen gibt, deren Vorliebe für Videospiele ihr ganzes Leben dominiert und die auch gegen den eigenen Willen einfach nicht aufhören können zu spielen, darüber sind sich Forscher grundsätzlich einig. Ebenso darüber, dass diesen Betroffenen geholfen werden sollte.

Kontrovers diskutiert wird jedoch der Vorstoß der Weltgesundheitsorganisation WHO, Gaming Disorder, also zu Deutsch Videospielsucht, als eigenständige Krankheit zu klassifizieren und im offiziellen Krankheitskatalog ICD-11 aufzulisten. Befürworter wie Prof. Matthias Brand sind überzeugt, das wäre ein Fortschritt – auch weil es dadurch leichter würde, Forschungsprojekte zu finanzieren:

"Es hilft dabei, die Grundlagen-Mechanismen der Störung besser zu verstehen, wenn man entsprechende Forschungsgelder auch für diese Störungen zur Verfügung gestellt bekommt. Das heißt, es hilft sowohl auf der rein wissenschaftlich akademischen Ebene als auch insbesondere auf der Ebene der Betroffenen, um die es geht, um die besser diagnostizieren und therapieren zu können."

Matthias Brand beschäftigt sich an der Universität Duisburg-Essen mit der Erforschung der psychologischen und neurobiologischen Grundlagen von Verhaltenssüchten wie der Videospielsucht. Gegner des WHO-Vorstoßes wie Dr. Antonius van Rooij vom Institute of Mental Health and Addiction in den Niederlanden warnen wiederum vor Überschlagshandlungen. Sie haben sich in mehreren Diskussions-Papern bereits gegen das Vorhaben ausgesprochen.

billig liv 52 kaufen

Der Darm ist bei Parkinson oft träge, so dass sich eine Verstopfung entwickelt. Eine solche Obstipation kann auch schon als Frühzeichen von Parkinson auftreten.

Bei Männern zeigen sich manchmal Potenzprobleme (Erektile Dysfunktion). Diese Impotenz kann sowohl durch die Krankheit selbst als auch durch die Parkinson-Medikamente entstehen.

Achtung: Alle genannten Begleitsymptome können auch durch andere Erkrankungen ausgelöst werden, nicht nur durch Parkinson.

Parkinson-Patienten sind anfälliger für eine Demenz als die Allgemeinbevölkerung: Ungefähr ein Drittel der Patienten entwickelt im Krankheitsverlauf zusätzlich eine Demenz. Einigen Untersuchungen zufolge ist das Demenz-Risiko bei Parkinson sogar noch höher (bis zu 80 Prozent).

Zu den Symptomen der Parkinson-Demenz zählen in erster Linie eine gestörte Aufmerksamkeit und ein verlangsamtes Denken. Das ist ein wichtiger Unterschied zu Alzheimer - der häufigsten Form von Demenz. Alzheimer-Patienten leiden hauptsächlich unter Gedächtnisstörungen. Solche treten bei der Parkinson-Demenz dagegen erst in späteren Krankheitsstadien auf.

Mehr zum Thema lesen Sie im Beitrag Demenz bei Parkinson.

Mediziner nenen die Parkinson-Erkrankung auch primäres oder idiopathisches Parkinson-Syndrom (IPS). "Idiopathisch" bedeutet, dass keine greifbare Ursache für die Erkrankung gefunden werden kann. Dieser "echte" Parkinson macht etwa 75 Prozent aller Parkinson-Syndrome aus. Er steht im Fokus dieses Textes. Davon zu unterscheiden sind die seltenen genetischen Formen von Parkinson, das "sekundäre Parkinson-Syndrom" und das "Atypische Parkinson-Syndrom". Sie werden weiter unten kurz beschrieben.

Die Parkinson-Erkrankung geht von einer bestimmten Hirnregion aus, die sogenannte "schwarze Substanz" (Substantia nigra) im Mittelhirn. Diese Hirnregion enthält viel Eisen und den Farbstoff Melanin. Beides färbt die "Substantia nigra" auffallend dunkel (im Vergleich zum sonst hellen Hirngewebe).

In der "Substantia nigra" befinden sich spezielle Nervenzellen, die den Nervenbotenstoff (Neurotransmitter) Dopamin produzieren. Dopamin ist sehr wichtig für die Steuerung von Bewegungen. Beim Idiopathischen Parkinson sterben immer mehr Dopamin-produzierende Nervenzellen ab. Warum, weiß man nicht.

Durch diesen fortschreitenden Zelltod sinkt der Dopaminspiegel im Gehirn immer weiter ab – es entwickelt sich ein Dopaminmangel. Der Körper kann ihn eine lange Zeit ausgleichen: Erst wenn etwa 60 Prozent der Dopamin-produzierenden Nervenzellen abgestorben sind, macht sich der Dopaminmangel bemerkbar: Der Patient bewegt sich immer langsamer (Bradykinese) oder teilweise gar nicht mehr (Akinese).

Doch der Dopaminmangel an sich ist nicht die alleinige Parkinson-Ursache: Er bringt zudem das empfindliche Gleichgewicht der Nervenbotenstoffe außer Balance: Weil immer weniger Dopamin vorhanden ist, steigt zum Beispiel die Menge des Botenstoffes Acetylcholin relativ betrachtet an. Experten vermuten, dass dies der Grund für das Zittern (Tremor) und die Muskelsteifheit (Rigor) bei Parkinson ist.

Das Ungleichgewicht der Neurotransmitter bei Parkinson könnte auch schuld daran sein, dass viele Patienten zusätzlich depressiv werden. Denn man weiß, dass generell bei Depressionen das Gleichgewicht der Nervenbotenstoffe gestört ist. Der Zusammenhang zwischen Morbus Parkinson und Depression ist aber noch nicht abschließend geklärt.

Parkinson-Ursachen: Viele Vermutungen, wenige Beweise

Weshalb bei der Parkinson-Krankheit Nervenzellen in der "Substantia nigra" absterben, ist noch unklar. Forschungsergebnisse lassen vermuten, dass an der Entstehung von Parkinson mehrere Faktoren beteiligt sind.

So haben Wissenschaftler etwa herausgefunden, dass die Nervenzellen bei Parkinson-Patienten schädigende Substanzen nur unzureichend beseitigen können. Zellschädigende Stoffe sind zum Beispiel die sogenannten "freien Radikale". Das sind aggressive Sauerstoffverbindungen, die bei verschiedenen Stoffwechselprozessen in der Zelle entstehen.

Möglicherweise sind die Nervenzellen bei Parkinson-Patienten nicht fähig, diese gefährlichen Stoffe abzubauen, bevor sie Schaden anrichten. Oder aber die Entgiftungsfähigkeit der Zellen ist normal, aber es werden übermäßig viele "freie Radikale" bei Parkinson produziert. In beiden Fällen könnten sich die zellschädigenden Substanzen in den Nervenzellen anreichern und sie absterben lassen.

Daneben gibt es noch andere mögliche Parkinson-Ursachen, die derzeit diskutiert und erforscht werden.

Wenn ein Familienmitglied an Parkinson erkrankt ist, verunsichert dies viele Angehörige. Sie fragen sich, ob Parkinson vererbbar ist. In den allermeisten Fällen handelt es sich bei Parkinson aber um den oben beschriebenen idiopathischen Parkinson. Vererbung ist bei dieser sporadisch auftretenden Erkrankungsform kein Thema, glauben Experten.

Anders ist das bei den sogenannten monogenetischen Formen von Parkinson: Jede von ihnen wird durch die Veränderung (Mutation) in einem bestimmten Gen verursacht. Diese Genmutationen können an die Nachkommen weitergegeben werden. Monogenetische Formen von Parkinson sind also vererbbar. Sie werden oft auch als familiäres Parkinson-Syndrom bezeichnet. Zum Glück sind sie aber selten.

Im Unterschied zum idiopathischen Parkinson hat das symptomatische (oder sekundäre) Parkinson-Syndrom eindeutig erkennbare Ursachen. Dazu zählen:

  • Medikamente: Hemmstoffe des Dopamins (Dopaminantagonisten) wie Neuroleptika (zur Behandlung von Psychosen) oder Metoclopramid (gegen Übelkeit und Erbrechen), Lithium (gegen Depressionen), Valproinsäure (gegen Krampfanfälle), Kalziumantagonisten (gegen Bluthochdruck)
  • andere Erkrankungen wie Hirntumoren, Entzündungen des Gehirns (etwa infolge von AIDS), Unterfunktion der Nebenschilddrüsen (Hypoparathyreoidismus) oder Morbus Wilson (Kupferspeicherkrankheit)
  • Vergiftungen, etwa mit Mangan oder Kohlenmonoxid
  • Verletzungen des Gehirns

Das Atypische Parkinson-Syndrom entsteht im Rahmen verschiedener neurodegenerativer Erkrankungen. Das sind Erkrankungen, bei denen fortschreitend Nervenzellen im Gehirn absterben. Im Unterschied zum idiopathischen Parkinson-Syndrom betrifft dieser Zelluntergang aber nicht nur die "Substantia nigra", sondern auch andere Hirnregionen. Deshalb treten beim Atypischen Parkinson-Syndrom neben Parkinson-ähnlichen Beschwerden noch weitere Symptome auf.

liv 52 100mg preis deutschland

Der Sinn von Normen besteht darin, eine Vergleichbarkeitsbasis her- bzw. einen Vergleichbarkeitsbewertungsmaßstab bereitzustellen. Im Prinzip erscheinen beim derzeitigen Stand des Wissens fünf solcher Vergleichbarkeitskriterien sinnvoll: Definitions-Norm, konstruktiv-operationale Norm, statistische, funktionelle und ideale Norm.

Definitions-Norm. Zum Zwecke der Kommunikation und Verständigung werden Übereinkünfte oder Konventionen getroffen, was jeweils unter diesem oder jenem Definiendum (das zu Definierende) verstanden werden soll. Beispiel: Was soll Psychoanalyse, Implosion, Symptomverschreibung, Kongruenz bedeuten? Die normative Bedeutung einer Definition liegt in der Festlegung des Definitionsinhalts. Eine Definition ist im Grunde nichts anderes als eine begriffliche Normierung eines Wortes.

Konstruktiv-operationale Norm. In der Psychologie, Psychopathologie und Psychotherapie ist es nicht damit getan, die Begriffe zu definieren. Das wird seit Jahrhunderten mehr oder minder erfolglos gemacht. Eine richtige Ordnung und Forschungsbasis wird in unser Fach erst kommen, wenn zugleich zu den Definitionen auch konstruktiv-operationale Normen ausgearbeitet werden, wie Vorliegen, Nichtvorliegen oder die Ausprägung eines Vorliegens oder die Wahrscheinlichkeit davon intersubjektiv wiederholbar hergestellt bzw. überprüft werden kann. Beispiel in der Therapie: "Streifen Sie mit Ihrem rechten Zeigefinger über ihren linken Unterarm hin und her. Drücken Sie mal mehr, mal weniger dabei. Wie nennen Sie das, was Sie soeben erlebt haben?" Die PatientIn wird sich schwer tun, weil zwar das Tun - streichen, kitzeln, berühren, streifen - einen Namen hat, aber nicht diese spezifische Empfindung. Man kann nun sagen: Ok, Sie hatten soeben eine Empfindung, für die wir keinen Namen haben. Ich habe das Beispiel extra gewählt, um Ihnen zu zeigen, daß es für das Empfinden nicht wichtig ist, daß man einen Namen oder einen Begriff hat, sondern eine Empfindung ist eben eine Empfindung und kein Name. Empfinden ist Empfinden, Denken ist Denken. Können Sie mir nun eine ähnliche Aufgabe stellen, damit ich sehen kann, ob ich es Ihnen richtig erklären konnte?" Man kann den Versuch so lange durchführen, bis PatientIn die Sachverhaltsnormierung beherrscht.

  • Querverweis: Beispiel für eine konstruktiv-operationale Definition von phantasieren.


Statistische Norm. Bedeutet statistische Normen, z. B. relative Häufigkeiten oder Wahrscheinlichkeiten, Prozentränge, d. h. kummulierte relative Häufigkeiten oder Wahrscheinlichkeiten, IQ-Werte, T-Werte, Schulnoten, Quantorenzuordnungen (> Normwerte). Ob statistische Normen bedeutsam sind, muß in jedem Fall erst einmal geprüft (validiert, evaluiert) werden. Schon gar nicht muß ein statistischer Extremwert etwas Pathologisches bedeuten. Ein extremer statistischer Normwert bedeutet zunächst sich selbst und sonst nichts. Ist eine Pathologieskala geeicht, dann ist ein statistischer Extremwert in aller Regel (Vorsicht: auch hier sind Ausnahmen möglich und besonders zu kontrollieren, z. B. bei Rentenbegehren, Opferentschädigungen) bedeutsam.

Exkurs: Verschiedene statistische Normbegriffe

Norm_Stat_Quer_Über_N. Hier wird über eine Stichprobe oder Population eine Querschnittsstatistik bezüglich eines festgelegten Zeitraumes erstellt. Typische Kennwerte einer solchen Querschnittsstatistik sind z. B. Median, Mittelwert, Standardabweichung, Quartile, Prozentränge. Anwendung Psychotherapieforschung: Vergleich z. B. der Symptomausprägung von Fall- und Kontrollgruppenwerten.

Norm_Stat_Längs_i. Hier geht es um eine statistische Längsschnittanalyse über ein Individuum, etwa bei Verlaufsforschungen, z. B. ganz typisch in der Psychotherapieforschung und Einzelfallevaluierung der Prae-Post-Vergleich.

Norm_Stat_Längs_Über_Quer_Über_N. Hier werden mehrere statistische Querschnittserhebungen einer bestimmten Stichprobe über die Zeit hinweg gemacht, z. B. in der Testevaluation für die Reliabilität-, Stabilitäts- und Ergodizitätsprüfung (Parameterkonstanz über die Zeit), wenn etwa die Gültigkeit von Normen, z. B. des HAWIE, überprüft wird. Ein sehr unangenehmes Problem ist hier die Stichprobenfluktuation: das Stichproben- Missing- Data- Problem. Empirisch ist es fast unmöglich, zwei genau gleiche Stichproben nach einem größeren zeitlichen Abstand wieder zusammenzubekommen.

Norm_Stat_Quer_Über_n-Bezüge_Dimension-i_bei_Indiv. DEF =: Eindimensionale Querschnitts-Statistik über n-Bezüge bei einem Individuum. Anwendungsbeispiel: (1) Lebenszufriedenheitstest LZS. (2) Alle Testskalen, die beanspruchen, Information zu einer Dimension zu erheben, z. B. Depressions- oder Angstskala. Hier wäre es ein Fehler, wenn Äpfel und Birnen zusammengewürfelt würden.

Norm_Stat_Quer_Über_n-Dimension-i_bei_Indiv. Einführung: Hier werden Äpfel und Birnen zusammengeworfen und es wird ein komplexer, mehrdimensionaler Indexwert gebildet. Solche komplexen, d. h. zusammengesetzten, mehrdimensionalen Größen spielen in vielen Wissenschaften und Lebensbereichen eine Rolle. Die Qualität einer Wohnung, die Qualität eines Lebens, die Qualität einer Beziehung, der Therapieerfolg sind typische Beispiele für mehrdimensionale, komplexe, d. h. zusammengesetzte Größen. Mit der LGW Lebensgrundsatzskala habe ich z. B. einen solchen Indexwert für die Selbstheilungskraft eines Menschen gebildet (Sponsel 1984).

Funktionsnorm. Hier ist das Normkriterium eine Funktion, z. B. laufen, heben, sprechen, lieben können. Als Funktionsnorm kann man aber auch ganz allgemein das Gesamtbefinden hernehmen. Eine Störung oder Krankheit ist funktionell unbedeutend, wenn keinerlei oder keine nennenswerte Beeinträchtigung spürbar ist 1). Die Funktionsnorm kann u. a. als Orientierungs- und Bewertungsrahmen für die Beurteilung dienen, ob eine statistische Norm bedeutsam ist oder nicht.
Beispiel Napoleon. 2) Napoleon hatte einen statistisch extrem niedrigen Puls, nämlich eine Rate von 40 (statistische Mittelwertsnorm = 70), wie viele HochleistungssportlerInnen. Da Napoleon hierdurch keinerlei Funktionseinbußen erlitt, er konnte denken, schreiben, reiten, lieben, Kriege führen, muß man wohl sagen: sein statistisch extremer Puls ist funktionsnormiert bewertet als normal zu bezeichnen.

Idealnorm. Hier ist das Normkriterium ein Ideal, in der Regel nach traditionellen oder individuellen Werten (Schönheit, Rechtmäßigkeit, Richtigkeit, Begründetheit usw.). Idealnormen spielen auch in der Wissenschaft eine große Rolle, nämlich in den wissenschaftlichen Grundfragen: ist eine Theorie richtig, wie gut ist sie begründet und bestätigt, wie viel Unklarheit oder Widersprüche ergeben sich in oder mit ihr? Ideale spielen auch in der Psychotherapie eine ganz bedeutende Rolle. Das Selbst-Ideal ist z. B. ein wesentlicher und grundlegender Begriff in der Psychodynamischen Psychotherapie, aber auch in der Krankheitslehre bei Rogers und in der Gesprächspsychotherapie.

Grundlagen und die drei Tatsachen jeglicher Normierung

Damit ein Sachverhalt normiert werden kann, muß es ihn "geben": er muß in irgendeiner Form für die Kommunizierenden, die ihn verwenden wollen, "existieren". Ist die "Existenz" - in welcher Welt [zu den verschiedenen Weltkonzepten in der GIPT] sei zunächst einmal offen gelassen - gesichert, so ist im Prinzip auch eine Normierung möglich. Normieren heißt im wesentlichen, vergleichen bezüglich als Norm ausgezeichneten Sachverhalts. Jede Normierung beruht auf drei Tatsachen: 1) Existenz, 2) Möglichkeit einer Normierung und 3) Einigung oder Übereinkunft (Konvention) auf eine Auswahl der Möglichkeiten zur Auszeichnung und Festlegung als Norm.

Die Relativität jeglicher Normierung

Jede Norm beruht auch auf einer Übereinkunft, hängt also auch ab von der Bezugsgruppe der zur Norm Übereinkommenden. Aus dem Bereich der Möglichkeiten wählen die Übereinkommenden Teilbereiche für ihre Normen aus. Im Bereich der Sprache und des Verhaltens kommt es dann durch den entsprechenden Gebrauch der Auswahlen durch die Kommunizierenden zu einer Verankerung in der Wissenschaft-, Bildungs- und Alltagskultur, so daß bei naiver Betrachtung gewisse normative Erscheinungsformen normativen Verhaltens für Fakten und Tatsachen gehalten werden (so etwas tut man / nicht). Die Relativität jeder Norm ist eine zweifache: (1) die relative Willkür bei der Auswahl der Möglichkeiten (2) durch die Bezugsgruppe der Übereinkommenden. Normen sind daher nicht richtig, wahr oder falsch, sondern ähnlich wie Definitionen mehr oder weniger zielangemessen und zweckdienlich oder nicht. Absolute Normansprüche sind daher wissenschaftlicher Unsinn und zu verwerfen.

Der Wertbegriff und seine Normierung

Wert, y GIPT Werten, y GIPT Werten_primär. Ein Sachverhalt erhält einen Wert, indem die psychologische Elementarfunktion y GIPT Werten auf ihn angewendet wird. werten führen wir (1) auf die Elementarfunktion y GIPT Wünschen und ihre Kontradiktion ( y GIPT Nicht [Wünschen [. ]) zurück. Ein Sachverhalt erhält also in dem Maße einen Wert, wie er gewünscht oder nicht gewünscht wird.
(2) y GIPT Empfinden_fühlen_spüren 3) dem Ereignisstrom richtig zuordnen können bezeichnen wir als y GIPT Werten_primär.

Der Begriff der Abweichung und seine Normierung

Der Begriff der Abweichung ist zentral für die Beurteilung und Abschätzung des Therapieerfolgs, selbst wenn nur einmal katamnestisch erhoben würde. Auch dann wären die dort erhobenen Werte mit anderen zu vergleichen und das heißt, man würde die Abweichung ermitteln. Daher setzt der Begriff der Abweichung eine Ausprägungs-, Schätz-, Meß- oder eine Abstandsfunktion 4) und eine hieraus entwickelte Skala bzw. Skalierung voraus. Man beachte: Eine statistische Abweichung besagt für sich noch nichts. Abweichungen gelten immer relativ zu einem Meßsystem und Meßverfahren. In der Psychotherapie sind das sehr oft subjektive Schätzungen, z. B. "ich habe sehr starke Angst". Das Wort abweichendes Verhalten beruht im Prinzip, wie die Namensgebung ja schon verrät, auf einer Abstandsdefinition gegenüber einer Bezugsnorm.

Allgemein braucht man für eine fundierte Theorie der Abweichungen eine Theorie der Ausprägungs-, Schätz- oder Maßeinheiten. Solche Ausprägungs- und Maßeinheiten, die für die praktische Anwendung der Psychologie und Psychotherapie tauglich sind, können mit Hilfe der sog. "Quantoren" in Anwendung auf bestimmte psychische Gegenstandsbereiche (z. B. nach Grundfunktionen klassifiziert: Fühlen, Wollen, Handeln, Befinden, Fähig sein,. ) normiert und geeicht werden.

Normierung der Einheiten mit Hilfe der Quantoren
in Psychologie & Psychotherapie 5)

Auswahl_Quantoren (Qualitaet)
z. B.: was, welche von. wählen, auswählen, entscheiden
Sehr bedeutsam bei den Therapiezielen, aber auch den Methoden und wo man den Hebel ansetzt in der Psychotherapie. Wichtig für die Indikationsfrage und natürlich für die Erstellung des Therapieplans.

Begrenzungs_Quantoren
z. B.: Mindestens, höchstens, von. bis, ab, bis
Hier ist das Problem der Grenzen, Bereiche, Anfang und Ende angesprochen. Was soll mindestens erreicht werden? Wo hören wir auf, geben uns zufrieden? Auch das Gebiet der Bedingungen ist berührt: notwendig, hinreichend, höchstens, mindestens, für den Bereich i. j.

Beschleunigungs_Quantoren
z. B.: gleichförmig, beschleunigt ansteigend (flach, steil), beschleunigt verlangsamend (flach, steil): Bremsen.
Bei maniformen Prozessen laufen viele Funktionen beschleunigt ab, während in der Depression der umgekehrte Effekt, die Verlangsamung und Hemmung zu beobachten ist. Bei Symptomverläufen interessiert auch der Verlauf: Bricht es plötzlich herein? Wie schnell entwickelt sich die Symptomatik? Bei allen Wachstumsprozessen z. B. beim Lernen in
der Psychologie stellt sich die Frage, ob der Lernzuwachs beschleunigt verläuft. Die Vergessenskurve von Ebbinghaus ist ebenfalls keine lineare, sondern eine abnehmend negativ weniger beschleunigte Funktion.

liv 52 0 100mg kaufen

Solltet ihr also jemanden kennen, der unter dieser Krankheit leiden könnte, schickt ihm den Link zu diesem Artikel!

Tracey Cox ist eine internationale Sex-, Körpersprache- und Beziehungsexpertin und Moderatorin. Sie ist bekannt für ihre Fernsehsendungen zum Thema Sex und Beziehungen und ihre Bestseller, welche weltweit millionenfach verkauft wurden.

Politische Beiträge und philosophische Essays

Die tiefste Krankheit der westlichen Welt: die Abkehr vom ethischen Objektivismus

Die gesamte westliche Welt ist vom Weg abgekommen. So sehr, dass sie sich selbst zu zerstören droht. Wie konnte es so weit kommen? Um diese Frage zu beantworten, muss man verstehen, was eine Gesellschaft im Innersten zusammenhält. Es ist dies die gemeinsame Vorstellung, was gut und was böse, was richtig und was falsch ist. Geht das verloren, fehlt der innere Kitt, der innere Zusammenhalt. Der Skeptizismus, in seinen Spielarten des Subjektivismus und Relativismus, hat genau dies zerstört. Der Kulturrelativismus fußt auf dem ethischen Relativismus. Was wäre also die richtige Medizin, wenn nicht die Rückkehr zum ethischen Objektivismus?

Jede Gesellschaft braucht gemeinsame Moralvorstellungen

Gesellschaften werden innerlich zusammengehalten durch eine gemeinsame Geschichte, eine gemeinsame Sprache, eine gemeinsame Kultur, eine gemeinsame Tradition, Riten, Sitten, vor allem aber durch gemeinsame Wertvorstellungen und Normen, durch eine gemeinsame Moral. Das ist quasi der innere Kitt, der eine Gesellschaft zusammschweißt. Was aber genau versteht man unter einer Moral?

Unter Moral versteht man

  • ein Normensystem (Werturteilssystem), welches sich
  • auf menschliches Handeln bezieht und welches
  • im Gegensatz zu rein subjektiven Geschmacksurteilen, Konventionen (z.B. Tischsitten) und Bräuchen (Konventionen mit längerer Tradition) einen kategorischen Anspruch auf unbedingte Gültigkeit erhebt.

Beispiele für moralische Normen (Ge- und Verbote):

  1. Du sollst nicht morden.
  2. Gib keine Versprechen, in der Absicht, sie nicht zu halten.
  3. Quäle nicht unnötig fühlende Wesen. Auch Tiere nicht.
  4. Versuche deine Sichtweise nicht mit Gewalt oder Einschüchterung durchzusetzen.
  5. Verhindere nicht die Erforschung der Wahrheit nur aus Angst, sie könnte deine Weltanschauung in Frage stellen oder zerstören.
  6. Du sollst Menschen nicht auf Grund ihres Geschlechts, ohne jeden sachlichen Grund systematisch benachteiligen.
  7. Verbiete anderen nicht bei Androhung von Gewalt oder durch Einschüchterung, deine Weltsicht zu kritisieren.
  8. Diskriminiere nicht Menschen auf Grund anderer spekulativer metaphysischer Vorstellungen und bedrohe sie nicht mit dem Tode, wenn sie sich von den von dir präferierten Vorstellungen abwenden.
  9. Foltere niemanden und peitsche niemanden öffentlich aus. Verstümmle niemanden. Hacke niemandem die Gliedmaßen ab und steche niemandem die Augen aus.
  10. Du sollst kleine Kinder nicht an ihren Genitalien verstümmeln und Kinder nicht sexuell missbrauchen, auch nicht wenn du sie anschließend oder vorher heiratest.

All dies sind Normen, die nicht nur für bestimmte Personen gelten sollen, sondern für alle. Und zwar immer und überall, unabhängig von persönlichen Vorlieben und persönlichen Zielen, die man gerade verfolgt.

Dies ist ein gravierender Unterschied zu rein persönlichen Geschmacksurteilen oder zu bloßen Konventionen, Sitten und Bräuchen, die keine unbedingte Gültigkeit beanspruchen. Wenn jemand sagt, er findet, man solle nicht morden und Versprechen wenn möglich nicht brechen, dann meint er normalerweise nicht, dass nur er sich aus persönlichen Vorlieben dafür entschieden hat, dies nicht zu tun, und es ihm egal ist, was andere diesbezüglich machen, sondern er meint, dass er es gut fände, wenn alle sich an diese Normen hielten, dass er dies geradezu erwartet. Genau das macht die Moralität der Norm aus.

Dabei haben verschiedene Gesellschaften und Kulturen unterschiedliche solche Norm- und Werturteilssysteme, also differierende Moralen. Und die Moralvorstellungen innerhalb einer Gesellschaft, die zum Teil in Gesetzen kodifiziert werden, insbesondere im Strafrecht, verändern sich im Laufe der Zeit, meist aber nicht in ihrer Essenz. Was ist nun aber der Unterschied zur Ethik? Sind das nicht nur verschiedene Worte für dasselbe?

liv 52 junior 100mg kautabletten montelukast nebenwirkungen

Die Morgellons-Haut- und System-Krankheit tritt zwar bereits weltweit auf. Mehr dazu und zur Frage der Ansteckbarkeit durch Morgellons.

Es ist aber immer noch eine "verschwiegene Epidemie", die vom Medizinestablishment entweder noch ignoriert bzw. als 'Delusional Parasitosis' (Dermatozoenwahn) verkannt wird.

Eine psychiatr. Beschreibung des echten Wahns s. hier

Links zu zahlreichen Mikroskop-Morgellons-Fotos und Erfahrungsberichten z.B.:

  • Frequently Asked Questions zu Morgellons (engl.)
    • mitunter kleine Lichtblitze
    • Abkapselung von Mikrofasern, Bindegewebeknoten
    • Depigmentation der Haut (helle Flecken) und Perforationen auf den weissen, erhabenen Flecken, die durch ein- und auswandernde Mikrorganismen entstehen.

    s. eine detailierte Symptomschilderung eines seit mehr als 10 Jahren davon Betroffenen (engl.) hier

  • Schwellung der Lymphknoten
  • Chronischer Morgellons-Krankheitsverlauf nach 8 - 12 Monaten

    Ausbreitungswege, Infektionsrisiko durch Morgellons

    Sind die Morgellons genetisch manipulierte Organismen, Nanoroboter oder was sonst?

    Aufschlussreiche Videos zu diesem brisanten Thema finden Sie bei YouTube unter den Stichworten "Morgellons / Biochemical Warheads – Crimes against Humanity", z.B. in http://www.youtube.com/watch?v=Gxs99wISMfA&playnext=1&list=PLFD7A61CDBBA713D0 (Teil 1 von 2)
    http://www.youtube.com/watch?v=ay4wZOLanDk&feature=related (Teil 2 von 2)

    Sind Lebensmittelzusatzstoffe E 1201(PVP) und E 1202 (PVPP) eine Mitursache?

    Mehr zum Thema Chemtrails- und Morgellons-Inhalte im Feinstaub

    • Nachweis von Polymerfasern per Mikroskop
    • Mikroskopbilder von Schneewasser- und Regenwasseranalysen
    • Gefahren durch besondere Kristallformen in Feinstaub?
    • Research and Videos: The Staninger Report by Hildegarde Staninger, Ph.D - MORGELLONS: A NANO-911 FOREIGN INVADER
    • Fiber Sensors in Morgellons (engl. Video)
    • Fibers in Morgellons
    • Morgellons - Identifying Marks
    • Morgellons - Advanced BioWarfare
    • Morgellon - Macrocycles
    • Insects fly out of permanent sores
    • Morgellons - Dictyostelium
    • Aerobiology and Toxins
    • MORGELLONS: COCOONS, WORMS, SYNTHETIC BIOLOGY, QUANTUM DOTS, SENSORS
    • MORGELLONS: Diamondoids (Carbon) Come Out of Morgellons' Victim's Skin
    • MORGELLONS: Nano Artifacts Identified-Polymer Brush Found in Skin: Stars, Ladders, Comb
    • MORGELLONS: The People Who Know-Ask Them How to Kill Polymer
    • MORGELLONS- Something About Polymer
    • Morgellons-Self-Assembling Organogel-June 7, 2010
    • Morgellons-Parasitic Infection-June 9, 2010
    • MORGELLONS-AntiOxidants, Sunlight, Peroxides, Free Radicals
    • Morgellons-Self-Assembling Organogel-June 7, 2010
    • Microbe Polymer Fibers-June 5, 2010
    • Morgellons-Nano Radio Transmitters-June 3, 2010
    • MORGELLONS: WHERE DO THE FIBERS COME FROM?
    • MORGELLONS: BioStructure-Micelles, Dendrimers, Bioadhesives, Time Release
    • MORGELLONS: Time Release Implant
    • MORGELLONS IS A GENETIC WEAPON
    • MORGELLONS HORROR PICTURE SHOW NANOTECHNOLOGY 2010
    • NASA SIGNED ITS NAME ON MORGELLONS FIBER
    • HEXAGON FOUND IN SKIN--Light Activated-Similar patent 5226902
    • Semiconductor Parent/Child Hexagons Come Out of Skin
    • HEXAGON FOUND IN SKIN--Light Activated-Similar patent 5226902
    • Who Made Morgellons?
    • MORGELLONS IS A GENETIC WEAPON
    • Morgellons: NASA has Cyclodextrin Lab-Navy Defense Research 1994
    • MORGELLONS POPULATION CONTROL-INFERTILITY
    • NASA, NASA, NASA-MORGELLONS-INFERTILITY
    • TRANSGENIC WEAPON
    • Morgellons The Reaper: Aluminum, Barium, Mycoplasma
    • What Did They Do To Our Hair?
    • MORGELLONS GROWS BLOOD VESSELS
    • REAL SENSORS SWARM UNDER MORGELLONS SKIN
    • Silicon Nanowires In Blood for Imaging
    • Living Polymerization, RAFT, CSIRA, DUPONT and Nematodes Von: skizi
    • The Polymer Knocks and The Cell Says "Come In"
    • FUNGUS AMONGUS
    • Bioterrorist Products developed in S-Series Agriculture Program
    • MORGELLONS: What Are spherulites?
    • MORGELLONS-Biofiber Living Polymer Catalyzed by Metals-Funded DOE & NSF
    • MORGELLONS-Encapsulated Bacteria Research by DOE

    • Bin ich hochsensibel?
    • Hochsensibilität auf dem Lebensweg
    • Was kann ich nicht ändern?
    • Was kann ich ändern?

    "Ich bin jemand. Ich bin ich. Ich bin gerne ich. Und ich
    brauche niemanden, der mich zu jemandem macht."

    (Louis L'Amour)

    Bin ich hochsensibel?

    Endlich können hochsensible Menschen aufatmen: das von Elaine N. Aron in den Neunzigerjahren erstmals beschriebene Phänomen der Hochsensibilität existiert tatsächlich und wird langsam einer wachsenden Anzahl von Menschen bewusst.
    Viele HSP werden dadurch befreit von einem oft lebenslangen Gefühl: "ich bin anders, ich bin nicht richtig so, wie ich bin": Es gibt uns! Nur schon diese Tatsache kann einen erlösenden Einfluss auf einen hochsensiblen Menschen haben: Sie/er fühlt sich vielleicht nicht mehr isoliert, ist gar froh, nicht "verrückt" zu sein - und lernt langsam, die persönliche Sensibilität zu erkennen und zu schätzen. Man liest und hört in Berichten hochsensibler Menschen oft, dass es für sie eine Zeit vor der Entdeckung ihrer Hochsensibilität - und eine Zeit danach gibt - und dass das "Nachher" eine entscheidend positivere Lebensqualität aufweist.

    Hochsensibilität auf dem Lebensweg

    Den hochsensiblen Menschen nun in einer Kurzzusammenfassung vollständig und umfassend zu beschreiben, ist nicht gut möglich, denn jede HSP ist ein Individuum, welches seine Hochsensibilität auf ganz persönliche Art auslebt. Klar existieren dennoch - in verschiedenem Masse - auch viele Ähnlichkeiten zwischen hochsensiblen Menschen (siehe weiter unten bei "Was können Sie nicht ändern/Was können Sie ändern").

    Was können Sie nicht ändern?

    • Ihre Veranlagung, welche beinhaltet, dass Ihre Wahrnehmung und die Art Ihres Temperaments nicht der Norm entsprechen, sondern einer hochsensiblen Minderheit (ca. 15-20 Prozent der Menschen). Ebenso können Sie leider Ihre Vergangenheit nicht mehr ändern, falls diese traumatische, belastende Erfahrungen beinhaltete, die sie zu einem hochempfindlichen Menschen machten.
    • Aus diesem Grund können Sie somit schneller eine Reizschwelle erreichen und sich schneller von Reizen (äusseren oder inneren) überflutet, überstimuliert und nervlich übererregt fühlen als Normalsensible, weil Ihr Gehirn weniger gut in der Lage ist, Reize, welche normalerweise als unwichtiger erkannt werden, herauszufiltern. Es ist nicht so, dass Normalsensible nie überreizt sind, - ihre Reizschwelle ist lediglich höher angesetzt.
    • Eventuell sind auch ihre Körpersinne (z.B. Augen, Ohren, Geruchsinn, Tastsinn. ) und ihre Fähigkeit, unterschwellige Reize wahrzunehmen, differenzierter - und führen Sie daher oftmals zu Überstimulation und Übererregung.
    • Vielleicht funktioniert auch Ihr Körper nicht so, wie sie es gerne hätten: vielleicht erträgt er diverse Genussmittel nicht, hat Mühe mit Schlafen - oder Sie müssen bei Ihrer Ernährung sorgfältiger sein als Ihre normalsensiblen Freunde. Vielleicht leiden Sie auch unter Allergien und Überempfindlichkeiten.

    Was können Sie ändern?

    Wichtige Vorbemerkung: Die Vorstellung, "sich zu ändern" ruft bei vielen Menschen schon Gefühle der Überforderung und daher Abwehr hervor: "ich soll mehr rauskommen, als ich in der Lage bin", "ich soll Dinge tun, die mir widerstreben", "ich soll. " So ist dies natürlich nicht gemeint. Es geht in keiner Weise darum, sich selber zu stressen und das frühere Gefühl von Überforderung und Überreizung aufrecht zu erhalten. Wandel kann nur stattfinden, wenn wir den Weg dazu mit unserem individuellen Naturell in Einklang bringen. Vielleicht ist es auch wichtig, sich zuerst einmal wertfrei zu fragen: Will ich mich überhaupt verändern? Bin ich bereit dazu? Und was möchte ich tatsächlich verändern?

    • "Ich bin richtig, so wie ich bin!" Sie können Ihr Gefühl langsam verändern, sie seien "nicht normal" und würden dauernd etwas "falsch machen", wenn Sie sich schneller überstimuliert, überfordert und "am Rand der Nerven" fühlen als normalsensible Menschen.
    • "Ich muss mich nicht mit andern vergleichen." Sie können ein wachsendes Bewusstsein darüber entwickeln, wer Sie eigentlich wirklich sind. Lernen Sie also, sich nicht mehr mit anderen zu vergleichen und nicht mehr zu versuchen, sich an deren Realität anzupassen. Dieser neue Weg braucht vielleicht viel Geduld. Ihre jahrelangen Gewohnheiten können Sie meistens nicht nullkommaplötzlich ändern, und ich würde denken, dass dies noch vermehrt der Fall ist, wenn Sie nicht mehr ganz jung und flexibel sind (obwohl hier positiv mitwirkt, dass HSP häufig "SpätzünderInnen" sind und sich auch im höheren Alter noch als recht "jung" wahrnehmen.)
    • "Wie nehme ich die Welt wahr?" Sie können damit beginnen, kontinuierlich Ihre Art der Wahrnehmung zu hinterfragen, zu studieren - und zu akzeptieren. Unsere persönliche Wahrnehmung kommt uns immer als die "richtige Sicht" vor: fragen Sie sich, ob es wirklich immer die "richtige" Sicht ist? Vielleicht nehmen andere Menschen ja eine Situation nur anders wahr - und wollen Sie z.B. gar nicht brüskieren und verletzen? Wir müssen lernen, sowohl unsere wie fremde Wahrnehmungen als das zu sehen, was sie sind: persönliche Wahrnehmungen.
        • "Ich habe keine Lust mehr, mich immer zu stressen." Wagen Sie es, vom Leistungsstress wegzukommen und sich dafür vielmehr mit Ihrer wachsenden Selbstachtung zu befassen.
        • "Ich werde mein eigener Manager, meine eigene Managerin. " Beginnen Sie damit, ein gesundes Selbstmanagement zu entwickeln, was viel mit Selbstverantwortung zu tun hat. Fragen Sie sich, ob Sie bis jetzt vielleicht noch nicht wirklich die Verantwortung für sich übernommen haben, weil Sie sich dazu nicht in der Lage gefühlt haben?
        • "Wie fühle ich mich eigentlich?!" Lernen Sie den Umgang mit Ihren Gefühlen. (Manchmal braucht dies professionelle Begleitung, gerade, wenn man leicht von Gefühlen überwältigt wird. Seien Sie diesbezüglich selbstverantwortlich.) Es könnte sein, dass Sie Ihre Gefühle gar noch nicht richtig kennen und einmal einen geschützten Rahmen brauchen, um sie kennen zu lernen.
        • "Ich entdecke meine starken Seiten. " Machen Sie sich also auf einen, Ihnen entsprechenden Weg, Ihre Energien nicht mehr in Gefühle des Andersseins, in Scham- und Schuldgefühle, Wut und Groll, Angst und Leiden, Rückzugstendenzen, Opferbewusstsein, Hilflosigkeit oder Unsicherheit etc. zu investieren, sondern zu entdecken, was Ihre Stärken sind.
        • ". und ich nehme meine Schwächen an." Versuchen Sie aber gleichzeitig, vorhandene Schwächen anzunehmen. Sich selber annehmen, wie sie sind, ist für HSP ein sehr wichtiger Lernprozess, da sie sich selber gegenüber häufig negative Gefühle - bis hin zum Selbsthass entwickeln können. Entwickeln Sie vielmehr ein Bewusstsein darüber, dass das, was Sie bis jetzt vielleicht auf vielfältige Weise gequält und blockiert hat, ein anderes Extrem besitzt: nämlich eine positive Seite, ein Potenzial.
        • "Was verbirgt sich hinter meinen Schwächen?" Reflektieren Sie: Könnte es z.B. sein, dass Ihrer, bis jetzt so ungeliebten "Überempfindlichkeit" oder "Hysterie" oder "Schüchternheit" oder "Pingeligkeit bis zur Zwangshaftigkeit". vielleicht ganz andere Eigenschaften zugrunde liegen? Zum Beispiel eine hohe Feinfühligkeit, eine tiefe Intuition, unterschwellige Wahrnehmungsfähigkeiten bis zur 'Hellsichtigkeit', empathische Fähigkeiten, ein hoher Grad an Gewissenhaftigkeit, eine starke "kreative Ader"? (um nur ein paar Eigenschaften zu nennen. )
        • "Eigentlich habe ich einen klaren Durchblick!!" Machen Sie sich auch klar, dass ein schneller Überreizungszustand theoretisch wahrscheinlich auch Fähigkeiten zur Differenzierung und Selbstreflexion enthält, welche über das "normale" Mass hinausgehen.
        • "Wie kann ich mir helfen?" Und werden Sie sich bewusst, dass bedrohliche Gefühle wie zum Beispiel erhöhte Verletzlichkeit, Angst, Panik, Konkurrenzgefühle oder Schuldgefühle. nicht unwiderruflich zu Ihrem Leben gehören müssen, sondern mit Ihrer bisher nicht erkannten Hochsensibilität im Zusammenhang stehen könnten. Seien sie in der Erforschung dieser Punkte ausdauernd, holen Sie sich Hilfe, wenn nötig - und vergessen Sie Ihre bisherige Ausdauer in Eigenschaften wie, sich selber kleiner zu machen als sie tatsächlich sind.
        • "I am 'somebody' - ich bin 'jemand' - durch meinen Körper. " Der englische Ausdruck "somebody" ("ein Körper") für "jemand" zeigt sehr schön, dass es für einen Menschen eigentlich genügt, einen Körper zu haben, um daseinsberechtigt zu sein. Kennen und akzeptieren Sie Ihren Körper? Dies müsste zur Folge haben, dass Sie lernen, für sich in allen Lebenslagen wirklich zu sorgen. Die Zuwendung zu Ihrem Körper, falls Sie diesen bis jetzt vorwiegend "benutzt" haben, um auf dieser Erde zumindest irgendwie "sichtbar" und handlungsfähig zu sein, ist ein ganz wichtiger Punkt. Reflektieren Sie des weiteren, ob Sie ihren Körper bis jetzt gar abgelehnt – oder an verschiedene ÄrztInnen oder HeilerInnen "delegiert" haben, weil er Ihnen mehr Mühe als Freude bereitet.

    liv 52 oral jelly 60mg günstig kaufen

    Mutationen sind wichtige Faktoren der Evolution, denn durch sie verändert sich das Genom der Organismen. Vergleichen wir die Aminosäresequenz der b -Kette des Hämoglobins bei verschiedenen Tieren (siehe oben), stellen wir Unterschiede fest, je nach Verwandschaftsgrad. Je näher die Verwandschaft, desto identischer die Sequenz. Bei allen Tieren erfüllt das Molekül seine Funktion. Die Umweltverhältnisse entscheiden, welche der spontanen Mutationen sich positiv oder negativ für den Merkmalsträger auswirkt (=Selektion). (siehe Sichelzellanämie oder HIV-Resistenz)

    Beispiele für Genmutationen

    Viele Krankheiten bei Mensch, Tier und Pflanze beruhen auf Genmutationen:

    Sichelzellanämie, Phenylketonurie, Alkaptonurie, Albinismus, Zellweger Syndrom, Marfan Syndrom usw.

    Doch nicht immer wirkt sich eine Genmutation negativ aus.

    1. HIV-Resistenz
    Ca.1% der Menschen in Europa sind immun gegen eine Infektion des HIV-Virus. Untersuchungen ergaben, daß diese Personen auf Chromosom 3 zwei defekte (mutierte) Gene des T-Zell und Makrophagen-Rezeptors CCR5 (= Chemokiner (C-C) Rezeptor 5) besitzen. Dieser ist als Korezeptor mit dem CD4-Rezeptor für die Injektion der HIV-Nukleinsäure in die Wirtszelle notwendig. Diese Menschen besitzen also eine homozygote Mutation, d.h. auf beiden Chromosomen sitzt das mutierte Gen.

    Der CCR5-Rezeptor gehört zu den G-Protein gesteuerten 7-Helix-Transmembran-Rezeptoren, die bei Immunreaktionen für die Signalübertragung mit Chemokinen (z.B. Interleukine) notwendig sind. Die Stimulation über diesen Rezeptor lösen bei Neutrophilen, Basophilen, Eosinophilens, Lymphocyten und Makrophagen eine Wanderung zum Infektionsort aus.

    Nachfolgend ist die Situation dargestellt.

    Das HIV-Virus benötigt zu seiner Infektion neben dem CD4-Rezeptor u.a. den CCR5 Korezeptor. Normalerweise besitzt der Mensch homozygot 2 Kopien des CCR5-Gens, das für den CCR5-Rezeptor verantwortlich ist. Er ermöglicht mit dem CD4 zusammen die Adsorption und Infektion (a). Nun gibt es einige Individuen, die bezüglich diese Gens einen homozygoten Defekt zeigen, d.h. beide Gene sind defekt und führen zu einem defekten Protein (b), das keine Infektion ermöglicht (c).

    Aus der Gendatenbank können wird die Sequenz des CCR5-Gens entnehmen (komplementäre DNA-Sequenz; entspricht der mRNA des Gens mit T statt U)

    Nukleotidsequenz des CCR5 Gens:

    ATG GATTATCAAGTGTCAAGTCCAATCTATGACATCAATTATTATACATCGGAGCCCTGC
    CAAAAAATCAATGTGAAGCAAATCGCAGCCCGCCTCCTGCCTCCGCTCTACTCACTGGTG
    TTCATCTTTGGTTTTGTGGGCAACATGCTGGTCATCCTCATCCTGATAAACTGCAAAAGG
    CTGAAGAGCATGACTGACATCTACCTGCTCAACCTGGCCATCTCTGACCTGTTTTTCCTT
    CTTACTGTCCCCTTCTGGGCTCACTATGCTGCCGCCCAGTGGGACTTTGGAAATACAATG
    TGTCAACTCTTGACAGGGCTCTATTTTATAGGCTTCTTCTCTGGAATCTTCTTCATCATC
    CTCCTGACAATCGATAGGTACCTGGCTGTCGTCCATGCTGTGTTTGCTTTAAAAGCCAGG
    ACGGTCACCTTTGGGGTGGTGACAAGTGTGATCACTTGGGTGGTGGCTGTGTTTGCGTCT
    CTCCCAGGAATCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCAGCTCT
    CATTTTCCATA CAGTCAGTATCAATTCTGGAAGAATTTCCAGACATTAAAGATAGTCAT
    CTTGGGGCTGGTCCTGCCGCTGCTTGTCATGGTCATCTGCTACTCGGGAATCCTAAAAACT
    CTGCTTCGGTGTCGAAATGAGAAGAAGAGGCACAGGGCTGTGAGGCTTATCTTCACCATC
    ATGATTGTTTATTTTCTCTTCTGGGCTCCCTACAACATTGTCCTTCTCCTGAACACCTTC
    CAGGAATTCTTTGGCCTGAATAATTGCAGTAGCTCTAACAGGTTGGACCAAGCTATGCAG
    GTGACAGAGACTCTTGGGATGACGCACTGCTGCATCAACCCCATCATCTATGCCTTTGTC
    GGGGAGAAGTTCAGAAACTACCTCTTAGTCTTCTTCCAAAAGCACATTGCCAAACGCTTC
    TGCAAATGCTGTTCTATTTTCCAGCAAGAGGCTCCCGAGCGAGCAAGCTCAGTTTACACCC
    GATCCACTGGGGAGCAGGAAATATCTGTGGGCTTGTGA

    schwarz:
    Normales Gen ist mit mutiertem Gen identisch

    rot:
    zum mutierten Gen unterschiedliche Nukleotidsequenzen


    Das mutierte Gen CCR5 Mutant hat folgende Sequenz:

    ATG GATTATCAAGTGTCAAGTCCAATCTATGACATCAATTATTATACATCGGAGCCCTGC
    CAAAAAATCAATGTGAAGCAAATCGCAGCCCGCCTCCTGCCTCCGCTCTACTCACTGGTG
    TTCATCTTTGGTTTTGTGGGCAACATGCTGGTCATCCTCATCCTGATAAACTGCAAAAG
    GCTGAAGAGCATGACTGACATCTACCTGCTCAACCTGGCCATCTCTGACCTGTTTTTCCTT
    CTTACTGTCCCCTTCTGGGCTCACTATGCTGCCGCCCAGTGGGACTTTGGAAATACAATG
    TGTCAACTCTTGACAGGGCTCTATTTTATAGGCTTCTTCTCTGGAATCTTCTTCATCATC
    CTCCTGACAATCGATAGGTACCTGGCTGTCGTCCATGCTGTGTTTGCTTTAAAAGCCAGG
    ACGGTCACCTTTGGGGTGGTGACAAGTGTGATCACTTGGGTGGTGGCTGTGTTTGCGTCT
    CTCCCAGGAATCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCAGCTCT
    CATTTTCCATA CATTAAAGATAGTCATCTTGGGGCTGGTCCTGCCGCTGCTTGTCATGGT
    CATCTGCTACTCGGGAATCCTAAAAACTCTGCTTCGGTGTCGAAATGA

    Der Nukleotidvergleich zeigt, daß ungefähr ab der Mitte des Gens die Sequenz verändert ist und dann ganz fehlt. Man nennt solche Löschungen von Teilen von Genen oder Chromosomen Deletion.

    Neben der Deletion gibt es noch andere Genmutationstypen. Wir wollen uns deshalb einmal das menschliche Hämoglobingen genauer betrachten. Hier treten u.a. in der Beta-Kette verschiedene Mutationen auf.

    2. Mutationen im Hämoglobin-Gen

    Bei der Sichelzellanämie ist in der b -Kette in Position 6 die Base A (GAG = Glutaminsäure) gegen T (GTG = Valin) ausgetauscht. Das Hämoglobin besitzt deshalb eine andere Konformation. Man bezeichnet eine solche Änderung nur einer Base als Punktmutation. Man spricht ebenfalls von einer Fehlsinn-Mutation, da die genetische Information. geändert wurde. Dies liegt auch beim Hb C vor. (siehe oben)

    Es gibt jedoch eine Krankheit, bei der noch eine andere Mutation im Gen der b -Kette des Hämoglobins vorliegt, die Thalassämie. Sie kann entweder durch eine Nonsens-Mutation oder eine Rastermutation verursacht werden.

    Bei der Nonsens-Mutation entsteht ein Stop-Codon, was zu einem Abbruch der Proteinsynthese und einem unvollständigen und nicht-funktionierenden Hämoglobin führt. Bei der Rastermutation fehlen zwei Basen (AA), was das Triplett-Raster so verschiebt, daß total andere Codogene entstehen und damit falsche Aminosäuren eingebaut werden, was ebenfalls zu einem defekten Hämoglobin führt.

    Die Thalassämie kann die a -Kette ( a -Thalassämie) oder die b -Kette ( b -Thalassämie) des Hämoglobins betreffen.

    Das Hämoglobin besitzt bekanntlich 2 a -Ketten und 2 b -Ketten (siehe oben). Das Gen für die b -Kette sitzt auf dem Chromosom 11. Das Chromosom 16 besitzt 2 Gene für die a -Ketten. Thalassämie entsteht, wenn ein Hämoglobingen defekt ist.

    Eine leichte Anämie und verkleinerte Erythrozyten treten erst auf, wenn 2 Gene defekt sind. Der Ausfall aller 4 Globin-Gene führt zum embryonalen Tod.

    a -Thalassämie tritt vornehmlich in Asien und Afrika auf.

    liv 52 junior 100mg kautabletten montelukast nebenwirkungen

    Ar­beits­recht ak­tu­ell 2011

    Ar­beits­recht ak­tu­ell 2010

    Ar­beits­recht ak­tu­ell 2009

    Letzte Überarbeitung: 5. Februar 2018

    Sie erreichen uns jeweils von Montag bis Freitag in der Zeit
    von 09:00 bis 19:00 Uhr:

    Hensche Rechtsanwälte
    Kanzlei Berlin

    Lützowstraße 32
    10785 Berlin

    Telefon: 030 - 26 39 62 0
    Telefax: 030 - 26 39 62 499

    Karl C. Mayer , Facharzt für Neurologie, Psychiatrie und Facharzt für Psychotherapeutische Medizin, Psychoanalyse

    Amyotrophe Lateralsklerose (ALS)

    Bei der ALS erkranken die Vorderhornzellen im Rückenmark und die motorischen Hirnnervenkerne im unteren Teil des Hirnstamms. Nervenimpulse die vom Gehirn ausgehen können so nicht mehr zur Muskulatur weitergeleitet werden. Die Kontrolle über die Muskulatur geht verloren. Da die entsprechenden Muskelzellen nicht mehr benutzt werden können, schrumpfen sie. Der Name beschreibt die Degeneration von motorischen Nervenfasern, die vom Gehirn ins Rückenmark ziehen mit Verlust von myelinisierten Nervenfasern und einer Gliose. Die Schädigung ist meist am ausgeprägtesten im unteren Rückenmark betrifft aber auch den Hirnstamm und sogar die Capsula interna. Die Veränderungen zeigen sich deutlich in den motorischen Vorderwurzeln des Rückenmarkes, wären die hinteren für die Sensibilität zuständigen Wurzeln intakt bleiben.
    Auch nicht mit den Lähmungen zusammenhängende Hirngebiete werden geschädigt. Bei vielen Verstorbenen finden sich Ubiquitinpositive Einschlusskörperchen im Gehirn dort besonders in Nervenellen des Hippocampus und frontotemporalen Nervenzellen. Letztere können für die manchmal vorkommenden kognitiven Defizite verantwortlich sein.

    Der bekannte Baseballspieler, Lou Gehrig’s der Physiker Stephen Hawking, Mao Tsetung, David Niven haben darunter gelitten In Deutschland besonders bekannt ist der Maler Jörg Immendorff, der offen über seine Erkrankung und die diversen unternommenen unkonventionellen Heilversuche spricht.

    Symptome: Schwäche und Atrophie der Muskeln, Faszikulationen und Muskelkrämpfe, Spastik, Dysarthrie, Dysphagie, Dyspnoe, emotionale Labilität. Wenn 30-50 % der Nervenzellen geschädigt sind, kommt es zu Muskelschwäche und Muskelschwund. Die gelähmten Muskeln scheinen dabei manchmal recht lebendig, da es bei dieser Erkrankung häufig zu unwillkürlichen Muskelzuckungen (Faszikulationen) oder wenn es die Zunge betrifft zu Fibrillationen kommt. You Tube Video mit Faszikulationen und Muskelatrophien. Eine Betroffene berichtet (engl.) Faszikulationen Die obersten motorischen Nervenzellen die Vorderhornzellen entsprechen liegen im Hirnstamm wenn dieser betroffen ist, ist die Augen (sehr selten)-,Sprach-, Kau- und Schluckmuskulatur geschwächt. Diese Form der ALS nennt man progressive Bulbärparalyse. Da auch darüber liegende zentrale motorische Nervenzellen der Hirnrinde und ihrer Verbindungen zum Rückenmark betroffen sein können kommt es bei vorhandener Schwäche auch zu einer Erhöhung der Muskelanspannung im Sinne einer Spastik. Die ALS betrifft nur das motorische Nervensystem (das für die Steuerung der Muskeln zuständig ist). Die Empfindung für Berührung, Schmerz und Temperatur, das Sehen, Hören, Riechen und Schmecken, die Funktionen von Blase und Darm sind nicht betroffen. Bei einem kleinen Teil der Betroffenen ist auch die geistige Leistungsfähigkeit beeinträchtigt. 2-5% der Patienten mit ALS leiden zusätzlich an einer frontotemporalen Demenz. Neuropsychologische Untersuchungen und die funktionelle Bildgebung zeigen, dass auch Patienten mit klassischer ALS neuropsychologische Defizite aufweisen können. Zu Lebzeiten nur motorisch betroffene Patienten zeigen neuropathologisch oft Atrophien des frontotemporalen Kortex. Umgekehrt finden sich bei Patienten mit frontotemporaler Demenz, die klinisch keine motorischen Einschränkungen aufweisen, neuropathologisch Atrophien der spinalen und bulbären Motoneurone. Ungeklärt ist, ob es sich bei der ALS mit neuropsychologischen Störungen um eine distinkte nosologische Entität handelt oder um einen Teil eines kontinuierlichen Spektrums, das von rein motorischen zu rein neuropsychologischen Symptomen verläuft. Im Verlauf droht den Patienten der langsame Erstickungstod, da die Atemmuskulatur regelmäßig betroffen wird. (A. Flöel, H. Lohmann, S. KnechtDer Nervenarzt 12/2002). Etwa 4% der Patienten leben länger als 10 Jahre mit der Erkrankung. Sekundär zu den Krankheitssymptomen kommt es bei vielen Patienten zu psychischen Störungen, Schlafstörungen, Verstopfung, Speichelfluss, verdicktem Bronchialsekret, Symptomen der chronischen Atemnot und Hypoventilation, Schmerzen M R Turner, et al., Prolonged survival in motor neuron disease: a descriptive study of the King’s database 1990–2002 J Neurol Neurosurg Psychiatry 2003; 74: 995-997. [Abstract] [Full text] [PDF] J D Mitchell, G D Borasio Amyotrophic lateral sclerosis Lancet 2007; 369: 2031–41

    • Schädigungs-Zeichen des oberen oder 1. Motoneurons: pathologische Reflexe oder gesteigerte Eigenreflexe, Kloni, spastische Tonuserhöhung, erhaltene Reflexe trotz Atrophie der Gliedmaße,
    • Schädigungs-Zeichen des unteren oder 2. Motoneurons: Schwäche, Atrophie, Faszikulationen

    Häufigkeit: 1-3 Fälle / 100000 Einwohner / Jahr oder etwa 6/100 000 Einwohner die derzeit mit der Erkrankung leben. Weltweit schätzungsweise 150000 ALS-Fälle, in Deutschland gibt es etwa 6000 Patienten mit einer ALS. An der sporadischen (nicht erblichen) Form leiden 90-95%, an der familiären Variante 5- 10%. Männer > Frauen (3:2). Bei etwa 5% der ALS-Patienten kommen weitere Krankheitsfälle in der Familie vor. Bei der sporadischen Form scheint häufig eine Mutation eines einzelnen Nukleotides im FLJ10986- Gen eine Rolle zu spielen. (N Engl J Med 2007;357:775-88). Das potentielle Substrat für FLJ10986 ist bisher nicht bekannt, damit ist auch nicht bekannt, wie es zur Auslösung der sporadischen Form der ALS beiträgt. ALS beginnt meist zwischen 50 und 70 Jahren, kann aber auch jüngere Menschen treffen. Die ALS tritt als sporadische (spontane) Form, familiäre Form (seltener, ca. 5-10% der Fälle), endemische (nur in einer bestimmten Region vorkommende, z.B. Guam, Kii Halbinsel) Form auf. ALS scheint bei Weißen häufiger zu sein als bei Afroamerikanern, Lateinamerikanern oder Asiaten. Die Ursache der ALS ist weiter unklar. Manche Studien weisen darauf hin, dass ein vererbtes Retrovirus verantwortlich sein könnte. Im Blut von ALS- Patienten und deren Blutsverwandten wurde eine im Vergleich zu Kontrollpersonen signifikant höhere Prävalenz der reversen Serumtranskriptase- Aktivität gefunden.

    Vesikel-assoziiertes Membranprotein/Synaptobrevin-assoziiertes Membranprotein B ( VAPB ) Gen

    CHMP2B (charged multivesicular body protein 2B),

    Die Diagnose wird oft erst sehr spät im Verlauf gestellt. Interessant ist dabei die Feststellung, dass der Hausarzt 3x schneller auf die Idee kommt und seine Patienten zum Neurologen zur Abklärung schickt als dies andere Fachärzte wie Rheumatologen tun. (Vorläufige Ergebnisse der „From First Symptoms to Diagnosis Study" Rh�ne-Poulenc Rorer GmbH. Es handelt sich um eine Ausschlußdiagnose. Die Diagnosekriterien der ALS sind als "El Escorial-Kriterien" international standardisiert und werden momentan überarbeitet ("erweiterte El Escorial-Kriterien"). Dies bedeutet, dass die Erkrankung erst diagnostiziert wird, wenn andere (besser behandelbare) Ursachen der Symptome ausgeschlossen sind. Insbesondere eine cervicale Myelopathie, motorische Neuropathien, Autoimmunerkrankungen (MS, Motorische Neuropathie mit multiplen Leitungsblöcken, Myasthenie, Einschlußkörperchen-Myositis, paraneoplastische Syndrome), toxisch infektiös oder durch Stoffwechselerkrankungen bedingte Polyneuropathien. Für diese Ausschlussdiagnostik sind entsprechende laborchemische Untersuchungen und eventuell auch radiologische Untersuchungen wie Kernspintomographien der Halswirbelsäule oder manchmal auch des Kopfes oder ein SSEP erforderlich. Eine Kernspintomographie der Halswirbelsäule oder des Kopfes dient also nicht dem Nachweis der Erkrankung sondern nur dem Ausschluss anderer Ursachen der Lähmungen. Manchmal ist auch eine Untersuchung des Nervenwassers im Rahmen der Ausschlussdiagnostik sinnvoll. Die Bestimmung der Blutgase und eine Lungenfunktionsprüfung kann im Verlauf sinnvoll sein um das Ausmaß der vorhandenen Beeinträchtigung der Atmung besser beurteilen zu können.

    Letztlich entscheidend für die Diagnose ist der neurologische Befund und der EMG- Befund. Bei der neurologischen Untersuchung finden sich Zeichen einer Spastik mit gesteigerten Muskeleigenreflexen und einem erhöhten Muskeltonus bei gleichzeitiger Muskelatrophie. Dabei Fehlen in der Regel sensible Ausfallserscheinungen. Der EMG- Befund ist, wenn man einen befallenen Muskel untersucht meistens typisch für die Erkrankung. Kein einzelner Befund alleine kann jedoch die Diagnose wirklich sichern. Genauso nachteilhaft wie zu späte Diagnosen, sind verfrühte und besonders nicht wirklich gesicherte Diagnosen. Ich selbst habe vor ein paar Jahren eine Patientin gesehen, bei der in einer renommierten neurologischen Klinik 12 Jahre zuvor die Diagnose ALS mitgeteilt worden war, und die außer einem leichten Restbefund einer Polyneuropathie beschwerdefrei war. Dabei aber wartete sie immer noch auf das Fortschreiten dieser schrecklichen Krankheit. Die Diagnose sollte deshalb nie von einem Neurologen alleine gestellt werden. Hier ist immer auch eine stationäre Einweisung um eine 2. und 3. Meinung einzuholen sinnvoll. Klinisch und neuropathologisch wird die ALS eingeteilt in die klassische ALS/PBP, bei der neben den Motoneuronen in Rückenmark und Hirnstamm ("zweite Motoneurone") auch die übergeordneten Motoneurone (sog. "erste Motoneurone" oder Betz´schen Riesenzellen) des präzentralen Großhirns zugrunde gehen, die progressive muskuläre Atrophie (PMA), bei der nur die Motoneurone des Vorderhorns zugrunde gehen. Die PMA betrifft dabei mehr als 10% aller ALS-Patienten. Sie führt ebenso zu fortschreitenden Lähmungen an Armen und Beinen, und zu Atemlähmung, seltener oder später aber zur Bulbärsymptomatik (was günstiger ist als bei der ALS). Reflexsteigerungen bzw. Zeichen einer begleitenden Spastik fehlen hier, da das 1. motorische Neuron nicht betroffen ist. Der Verlauf der PMA ist ansonsten dem Verlauf der ALS ähnlich, wobei die Überlebenszeit hauptsächlich wegen der später eintretenden Bulbärsymptomatik länger ist und bei bis zu 2/3 der Patienten bei mehr als 5 Jahren liegen soll. Eine Abgrenzung zu den Erwachsenenformen der spinalen Muskelatrophie ist meist erst durch den bei letzterer Erkrankung gutartigeren Verlauf möglich. Daneben gibt es die primäre Lateralsklerose (PLS), bei der die übergeordneten Motoneurone, nicht jedoch die Motoneurone des Vorderhorns zugrunde gehen.

    Häufigste Fehldiagnosen nach Chio J Neurol 1999 246 suppl 3

    Die Prognose ist nach wie vor schlecht. Alter, bulbäre Symptome beim Beginn, fehlen eines Partners, weibliches Geschlecht bedingen eine schlechtere Prognose, allgemein gute Gesundheit verbessert die Prognose hinsichtlich der Überlebenszeit. M.A. del Aguila, PhD, W.T. Longstreth, Jr, MD MPH, V. McGuire, PhD, T.D. Koepsell, MD MPH and G. van Belle, PhDPrognosis in amyotrophic lateral sclerosis A population-based study Neurology 2003;60:813-819

    Ein für die Behandlung der MS zugelassenes Medikament könnte nach den Ergebnissen von Tierversuchen an Mäusen eine Behandlung der ALS ermöglichen. Glatirameracetat (Copaxone ®), Eiweiß mit Ähnlichkeiten zu Eiweißen in der Nervenscheidewand muss bei MS- Kranken täglich gespritzt werden. Bei Mäusen führt eine Impfung mit Copaxone ® zu einer Lebensverlängerung, Nervenzellen am Gesichtsnerven der Mäuse überlebten doppelt so lange, wenn die Mäuse mit der Substanz geimpft wurden. Akute wie chronische Abbauprozesse von Nerven wurden durch die Substanz verzögert. Die Autoren der Studie vermuten, dass die Substanz über einen Schutz vor dem Autoimmunprozess wirkt, der für die vorzeitige Zerstörung der Vorderhornzellen im Rückenmark und motorischer Nervenzellen verantwortlich ist. Möglicherweise könnte das Medikament auch bei anderen Verletzungen von Nerven den Heilungsprozess beschleunigen.

    Tierversuche sind nicht immer auf den Menschen übertragbar. Bis Studien an Menschen überprüft haben, ob eine Wirkung der Substanz auch bei ALS vorhanden ist, wird es noch ein paar Jahre dauern. Das Medikament ist sehr teuer und wird die nächsten Jahre für die Behandlung der ALS nicht zugelassen sein. Bis jetzt gibt es für ALS- Patienten auch noch keinen Grund sich Copaxone ® zu besorgen. Angesichts des bisherigen Mangels an gut wirksamen Behandlungen für diese schreckliche Erkrankung wird es mit Sicherheit bald Studien geben. Diese zu beobachten lohnt sich auf jeden Fall. Die Injektion von Copaxone ® wird meist gut vertragen. Kurzdauernde Reaktion mit Beklemmungsgefühl und Flush-Symptomen wurden berichtet. Juckreiz und Schwellungen an der Injektionsstelle kommen ebenfalls vor. Eine laufende Nase, Tremor; ungewöhnliche Müdigkeit oder Schwäche sowie Gewichtszunahmen wurden berichtet. D. N. Angelov et al. PNAS 2003 100: 4790-4795;

    1. A. Chio, R. Mutani, G. Mora, W.T. Longstreth Jr., and M.A. del Aguila Prognosis in amyotrophic lateral sclerosis: A population-based study Neurology, December 23, 2003; 61(12): 1826 - 1827. [Full Text][PDF]
    2. Filme YouTube Wings Over Wall Street 07Motor Neuron DiseaseWhen every moment becomes precious.. English subtitles
    3. M. G. Weisskopf, E. J. O'Reilly, M. L. McCullough, E. E. Calle, M. J. Thun, M. Cudkowicz, and A. Ascherio
      Prospective study of military service and mortality from ALS Neurology, January 11, 2005; 64(1): 32 - 37. [Abstract][Full Text][PDF]
    4. P N Leigh, S Abrahams, A Al-Chalabi, M-A Ampong, L H Goldstein, J Johnson, R Lyall, J Moxham, N Mustfa, A Rio, C Shaw, and E Willey The management of motor neurone disease J. Neurol. Neurosurg. Psychiatry, December 1, 2003; 74(90004): iv32 - 47. [Full Text][PDF]
    5. K. Abe and J.-S. Lou Fatigue and depression are associated with poor quality of life in ALS Neurology, May 25, 2004; 62(10): 1914 - 1914. [Full Text][PDF]
    6. S. Abrahams, L. H. Goldstein, A. Simmons, M. Brammer, S. C. R. Williams, V. Giampietro, and P. N. Leigh Word retrieval in amyotrophic lateral sclerosis: a functional magnetic resonance imaging study Brain, July 1, 2004; 127(7): 1507 - 1517. [Abstract][Full Text][PDF]
    7. S. Maekawa, S. Al-Sarraj, M. Kibble, S. Landau, J. Parnavelas, D. Cotter, I. Everall, and P. N. Leigh Cortical selective vulnerability in motor neuron disease: a morphometric study Brain, June 1, 2004; 127(6): 1237 - 1251. [Abstract][Full Text][PDF]
    8. S. Abrahams, P. N. Leigh, and L. H. Goldstein Cognitive change in ALS: A prospective study Neurology, April 12, 2005; 64(7): 1222 - 1226. [Abstract][Full Text][PDF] R. S Howard and C. Davidson Long term ventilation in neurogenic respiratory failure J. Neurol. Neurosurg. Psychiatry, September 1, 2003; 74(90003): iii24 - 30. [Full Text][PDF]
    9. A. Chio, G. Mora, M. Leone, L. Mazzini, D. Cocito, M. T. Giordana, E. Bottacchi, and R. Mutani Early symptom progression rate is related to ALS outcome: A prospective population-based study Neurology, July 9, 2002; 59(1): 99 - 103. [Abstract][Full Text][PDF]
    10. W. G. Bradley, F. Anderson, M. Bromberg, L. Gutmann, Y. Harati, M. Ross, and R. G. Miller Current management of ALS: Comparison of the ALS CARE Database and the AAN Practice Parameter Neurology, August 14, 2001; 57(3): 500 - 504. [Abstract][Full Text][PDF]
    11. D. N. Angelov, S. Waibel, O. Guntinas-Lichius, M. Lenzen, W. F. Neiss, T. L. Tomov, E. Yoles, J. Kipnis, H. Schori, A. Reuter, A. Ludolph, and M. Schwartz Therapeutic vaccine for acute and chronic motor neuron diseases: Implications for amyotrophic lateral sclerosis PNAS 2003 100: 4790-4795; published online before print March 31 2003, 10.1073/pnas.0530191100 [Abstract][Full Text][PDF]
    12. Valentine, J. S., Hart, P. J. (2003). Bioinorganic Chemistry Special Feature: Misfolded CuZnSOD and amyotrophic lateral sclerosis. Proc. Natl. Acad. Sci. U. S. A. 100: 3617-3622 [Abstract][Full Text]
    13. ROWLAND, L; N Engl J Med, Vol. 344,1696 - No. 22 - May 31, 2001 - www.nejm.org
    14. M.A. del Aguila, PhD, W.T. Longstreth, Jr, MD MPH, V. McGuire, PhD, T.D. Koepsell, MD MPH and G. van Belle, PhDPrognosis in amyotrophic lateral sclerosis A population-based study Neurology 2003;60:813-819
    15. Lomen-Hoerth, C., Murphy, J., Langmore, S., Kramer, J. H., Olney, R. K., Miller, B. (2003). Are amyotrophic lateral sclerosis patients cognitively normal?. Neurology 60: 1094-1097 [Abstract][Full Text]
    16. Tiwari, A., Hayward, L. J. (2003). Familial Amyotrophic Lateral Sclerosis Mutants of Copper/Zinc Superoxide Dismutase Are Susceptible to Disulfide Reduction. J. Biol. Chem. 278: 5984-5992 [Abstract][Full Text]
    17. Mockett, R. J., Radyuk, S. N., Benes, J. J., Orr, W. C., Sohal, R. S. (2003). Phenotypic effects of familial amyotrophic lateral sclerosis mutant Sod alleles in transgenic Drosophila. Proc. Natl. Acad. Sci. U. S. A. 100: 301-306 [Abstract][Full Text]
    18. Jung, C., Higgins, C. M. J., Xu, Z. (2002). Mitochondrial electron transport chain complex dysfunction in a transgenic mouse model for amyotrophic lateral sclerosis. J Neurochem 83: 535-545 [Abstract][Full Text]
    19. Gamez, J., Barcelo, M. J., Munoz, X., Carmona, F., Cusco, I., Baiget, M., Cervera, C., Tizzano, E.F. (2002). Survival and respiratory decline are not related to homozygous SMN2 deletions in ALS patients. Neurology 59: 1456-1460 [Abstract][Full Text]
    20. Priori, A., Cinnante, C., Pesenti, A., Carpo, M., Cappellari, A., Nobile-Orazio, E., Scarlato, G., Barbieri, S. (2002). Distinctive abnormalities of motor axonal strength-duration properties in multifocal motor neuropathy and in motor neurone disease. Brain 125: 2481-2490 [Abstract][Full Text]
    21. Taylor, J. P., Hardy, J., Fischbeck, K. H. (2002). Toxic Proteins in Neurodegenerative Disease. Science 296: 1991-1995 [Abstract][Full Text]
    22. Johnson, M. A., Macdonald, T. L., Mannick, J. B., Conaway, M. R., Gaston, B. (2001). Accelerated S-Nitrosothiol Breakdown by Amyotrophic Lateral Sclerosis Mutant Copper,Zinc-Superoxide Dismutase. J. Biol. Chem. 276: 39872-39878 [Abstract][Full Text]
    23. Vandenberghe, W., Brorson, J. R., Rowland, L. P., Shneider, N. A. (2001). Amyotrophic Lateral Sclerosis. N Engl J Med 345: 1131-1132 [Full Text]
    24. Jubelt, B., Berger, J. R. (2001). Does viral disease underlie ALS?: Lessons from the AIDS pandemic. Neurology 57: 945-946 [Full Text]
    25. A. Chio, G. Mora, M. Leone, L. Mazzini, D. Cocito, M. T. Giordana, E. Bottacchi, and R. Mutani Early symptom progression rate is related to ALS outcome: A prospective population-based study Neurology, July 9, 2002; 59(1): 99 - 103. [Abstract][Full Text][PDF]
    26. M D Bradley, R W Orrell, J Clarke, A C Davidson, A J Williams, D M Kullmann, N Hirsch, and R S Howard Outcome of ventilatory support for acute respiratory failure in motor neurone disease J. Neurol. Neurosurg. Psychiatry, June 1, 2002; 72(6): 752 - 756. [Abstract][Full Text][PDF]
    27. W. G. Bradley, F. Anderson, M. Bromberg, L. Gutmann, Y. Harati, M. Ross, and R. G. Miller Current management of ALS: Comparison of the ALS CARE Database and the AAN Practice Parameter Neurology, August 14, 2001; 57(3): 500 - 504. [Abstract][Full Text][PDF]
    28. N. Lechtzin, C. M. Wiener, L. Clawson, V. Chaudhry, and G. B. Diette Hospitalization in amyotrophic lateral sclerosis: Causes, costs, and outcomes Neurology, March 27, 2001; 56(6): 753 - 757.[Abstract][Full Text][PDF]
    29. M. J. Rumbak and R. M. Walker Should Patients With Neuromuscular Disease Be Denied the Choice of the Treatment of Mechanical Ventilation? Chest, March 1, 2001; 119(3): 683 - 684. [Full Text]
    30. P. L. Murphy, S. M. Albert, C. M. Weber, M. L. Del Bene, and L. P. Rowland Impact of spirituality and religiousness on outcomes in patients with ALS Neurology, November 28, 2000; 55(10): 1581 - 1584. [Abstract][Full Text][PDF]
    31. Ganzini L, Johnston WS, McFarland BH, Tolle SW, Lee MA. Attitudes of patients with amyotrophic lateral sclerosis and their caregivers toward assisted suicide. N Engl J Med 1998;339:967–973. Full Text]
    32. H. Mitsumoto Patient choices in ALS Neurology, July 1, 1999; 53(2): 248 - 248. [Full Text][PDF]
    33. Farsides, B., Dunlop, R. J (2001). Measuring quality of life: Is there such a thing as a life not worth living?. BMJ 322: 1481-1483 [Full Text]
    34. Ganzini, L., Johnston, W. S., Silveira, M. J. (2002). The final month of life in patients with ALS. Neurology 59: 428-431 [Abstract][Full Text]
    35. A. J. Steele et al, Detection of serum reverse transcriptase activity in patients with ALS and unaffected blood relatives, NEUROLOGY 2005;64:454-458
    36. L. P. Rowland and N. A. Shneider Amyotrophic Lateral Sclerosis N. Engl. J. Med., May 31, 2001; 344(22): 1688 - 1700. [Full Text][PDF]
    37. N. Lechtzin, C. M. Wiener, L. Clawson, V. Chaudhry, and G. B. Diette Hospitalization in amyotrophic lateral sclerosis: Causes, costs, and outcomes Neurology, March 27, 2001; 56(6): 753 - 757. [Abstract][Full Text][PDF]
    38. P. L. Murphy, S. M. Albert, C. M. Weber, M. L. Del Bene, and L. P. Rowland Impact of spirituality and religiousness on outcomes in patients with ALS Neurology, November 28, 2000; 55(10): 1581 - 1584. [Abstract][Full Text][PDF]
    39. M. I Polkey, R. A Lyall, J. Moxham, and P N. Leigh Respiratory aspects of neurological disease J. Neurol. Neurosurg. Psychiatry, January 1, 1999; 66(1): 5 - 15. [Full Text]
    40. P J Shaw Molecular and cellular pathways of neurodegeneration in motor neurone disease J. Neurol. Neurosurg. Psychiatry, August 1, 2005; 76(8): 1046 - 1057. [Abstract][Full Text][PDF]
    41. Stephen C Bourke, Mark Tomlinson, Tim L Williams, Robert E Bullock, Pamela J Shaw, G John Gibson, Effects of non-invasive ventilation on survival and quality of life in patients with amyotrophic lateral sclerosis: a randomised controlled trial Lancet Neurol 2006; 5: 140–47
    42. Veldink, J. H., Wokke, J. H.J., van der Wal, G., Vianney de Jong, J.M.B., van den Berg, L. H. (2002). Euthanasia and Physician-Assisted Suicide among Patients with Amyotrophic Lateral Sclerosis in the Netherlands. N Engl J Med 346: 1638-1644 [Abstract][Full Text]
    43. www.dgm.orgDGM (Deutsche Gesellschaft für Muskelkrankheiten)
    44. Amyotrophe Lateralsklerose Leitliniehttp://www.dgn.org/33.0.html
    45. ALS C.A.R.E.
    46. Bundesfachverband Elektronische Hilfsmittel für Behinderte e.V.
    47. http://weka.rpr-cologne.de
    48. http://www.alsa.org/research
    49. http://www.wfnals.orgAmyotrophic Lateral Sclerosis Association (ALSA).http://www.wfnals.org/guidelines/1998elescorial/elescorial1998criteria.htm oder http://www.wfnals.org/guidelines/index.html
    50. World Federation of Neurology
    51. ALS Network
    52. The Roots of ALS Society for Neuroscience )
    53. Rh�ne-Poulenc Rorer, Inc. ALS Homepage
    54. Muscular Dystrophy Association
    55. Center for Neurologic Study
    56. International Alliance of ALS/MND Associations
    57. Neuroscience on the Internethttp://www.alssurvivalguide.com
    58. http://www.phoenix.com
    59. www.march-of-faces.org
    60. http://members.home.net/freyerse/
    61. http://www.rideforlife.com
    62. http://www.steveholly.com
    63. http://www.miami-als.org
    64. in http://www.neuroscript.com/ Darstellung der Medikamente für Medizinstudenten (nicht immer ganz aktuell da nach Prüfungskatalog)ALS
    65. Deutschlandfunk: Heilung unmöglich? (29.11.2004)
    66. Stern.de - Gefangenen im eigenen Körper (10.08.2004)
    67. Nichtinvasive intermittierende Selbstbeatmung (ISB) als Palliativmaßnahme bei amyotropher LateralskleroseV. Schlamp Der Nervenarzt 69/1998, S. 1074

    Therapeutische Strategien der ventilatorischen Insuffizienz bei amyotropher Lateralsklerose (ALS)B. Schönhofer Der Nervenarzt 69, S. 312

    Molekularbiologische Befunde bei der amyotrophen Lateralsklerose R. Bachus Neurologische Klinik, Universitätsklinikum Charité, Humboldt-Universität, Berlin –Der Nervenarzt 68/1997, S. 785

    Empfehlung der bayerischen Muskelzentren in der DGM zur Heimbeatmung bei neuromuskulären Erkrankungen Erwachsener M. Winterholler Der Nervenarzt 68/1997, S. 351

    Bitte beachten Sie, diese Webseite ersetzt keine medizinische Diagnosestellung oder Behandlung. Es wird hier versucht einen Überblick über den derzeitigen Stand der medizinischen Forschung auch für interessierte Laien zu geben, dies ist nicht immer aktuell möglich. Es ist auch nicht möglich, dass ein Arzt immer auf dem aktuellsten Stand der medizinischen Forschung in allen Bereichen seines Faches ist. Es ist immer möglich, dass die medizinische Forschung hier noch als wirksam und ungefährlich dargestellte Behandlungsmaßnahmen inzwischen als gefährlich oder unwirksam erwiesen hat. Lesen Sie bei Medikamenten immer den Beipackzettel und fragen Sie bei Unklarheiten Ihren behandelnden Arzt. Medikamentöse Behandlungen auch mit freiverkäuflichen Medikamenten bedürfen ärztlicher Aufsicht und Anleitung. Dies gilt auch für alle anderen Behandlungsverfahren. Die hier angebotenen Informationen können nicht immer für jeden verständlich sein. Um Mitteilung wo dies nicht der Fall ist bin ich dankbar. Fragen Sie hierzu immer Ihren behandelnden Arzt. Dieser weiß in der Regel über die hier dargestellten Sachverhalte gut Bescheid und kann Ihren individuellen Fall und Ihre Beschwerden besser einordnen- was für einen bestimmten Patienten nützlich ist, kann einem anderen schaden. Selbstverständlich gibt es zu den meisten Themen unterschiedliche Auffassungen. Soweit möglich wird hier dargestellt woher die Informationen stammen. In den meisten Fällen mit einem entsprechenden Link (da diese oft ohne Ankündigung geändert werden, sind diese leider nicht immer aktuell zu halten).. Leider ist die zitierte Literatur nicht immer kostenfrei zugänglich. Die Beschränkung auf kostenfrei zugängliche Literatur würde manches sehr oberflächlich lassen. In der Regel versuche ich mich in der Darstellung an deutschen oder internationalen Leitlinien der Fachgesellschaften und Metaanalysen der Literatur zu orientieren. Auch dies ist nicht überall möglich. Zum einen gibt es nicht überall solche Leitlinien, zum anderen werden diese mir nicht immer sofort bekannt. Manche Leitlinien sind lange nicht aktualisiert worden und von neuerer Literatur überholt, bzw, ergänzungsbedürftig. Wenn möglich sind im Text Links zu solchen Leitlinien eingebaut. Auch Leitlinien sind nur Orientierungen, sie schließen nicht aus, dass generell oder im Einzelfall Fehler enthalten sind oder diese im Einzelfall nicht anwendbar sind. Ziel der Darstellung ist hier definitiv nicht, mich als Experten für irgendeines der in der Homepage dargestellten Krankheitsbilder auszuweisen. Ich gehe davon aus, dass alle vergleichbaren Fachärzte für Neurologie, Psychotherapeutische Medizin und Psychiatrie ihre Patienten sorgfältig und genau so gut wie ich behandeln. Sollten Sie über eine Suchmaschine direkt auf diese Seite gekommen sein, werden Sie gebeten auch die Hauptseite aufzusuchen. Dort finden Sie einen Link zu den zuständigen Ärztekammern. Bitte lesen sie auch den Beipackzettel der Homepage und das Vorwort. Jeder Nutzer ist für die Verwendung der hier gewonnenen Informationen selbst verantwortlich, es handelt sich definitiv um keine Anleitung zur Selbstbehandlung. Es wird keinerlei Haftung weder für die hier angebotenen Informationen noch für die in den Links angebotenen Informationen übernommen. Sollten Sie Links finden, die nicht (oder nicht mehr) seriös sind, teilen Sie mir dies bitte mit, damit ich diese löschen kann. Der Autor übernimmt keinerlei Gewähr für die Aktualität, Korrektheit, Vollständigkeit oder Qualität der bereitgestellten Informationen. Haftungsansprüche gegen den Autor, welche sich auf Schäden materieller oder ideeller Art beziehen, die durch die Nutzung oder Nichtnutzung der dargebotenen Informationen bzw. durch die Nutzung fehlerhafter und unvollständiger Informationen verursacht wurden sind grundsätzlich ausgeschlossen, sofern seitens des Autors kein nachweislich vorsätzliches oder grob fahrlässiges Verschulden vorliegt. Alle Angebote sind freibleibend und unverbindlich. Der Autor behält es sich ausdrücklich vor, Teile der Seiten oder das gesamte Angebot ohne gesonderte Ankündigung zu verändern, zu ergänzen, zu löschen oder die Veröffentlichung zeitweise oder endgültig einzustellen. Veränderungen erfolgen dabei ständig in Anpassung an neue Literatur oder weil sich meine Auffassung zu einem Thema aus anderen Gründen geändert hat. Dieser Haftungsausschluss ist als Teil des Internetangebotes zu betrachten, von dem aus auf diese Seite verwiesen wurde. Sofern Teile oder einzelne Formulierungen dieses Textes der geltenden Rechtslage nicht, nicht mehr oder nicht vollständig entsprechen sollten, bleiben die übrigen Teile des Dokumentes in ihrem Inhalt und ihrer Gültigkeit davon unberührt. Sollte sich jemand durch die Homepage in irgendeiner Form beleidigt, benachteiligt oder in sonst einer Form geschädigt fühlen, bitte ich um eine persönliche Kontaktaufnahme per E-Mail oder telefonisch bzw. per Post. Bitte nennen Sie bei Mitteilungen Ihren vollständigen Namen und Ihre Adresse. Bei Mitteilungen von Kollegen bitte auch Tatsache, dass sie Kollege sind, sowie die Fachbezeichnung. Anonyme Mitteilungen sind in der Regel nicht willkommen. Karl C. Mayer

    Die Fachanwaltskanzlei

    Ξ Homepage
    Ξ
    Wir über uns
    Ξ Angebot
    Ξ Referenzen
    Ξ Publikationen
    Ξ Impressum
    Ξ Kontakt

    "Wann ist man wegen Krankheit von seiner Erwerbsobliegenheit befreit?"

    Aus dem Gebot der Eigenverantwortlichkeit und gegenseitigen Rücksichtnahme folgt, sowohl für den Unterhaltsgläubiger, als auch für den Unterhaltsschuldner grundsätzlich die Obliegenheit einer -> Vollzeittätigkeit nachzugehen (-> Erwerbsobliegenheiten nach deutschem Unterhaltsrecht). Wer gegen diese Erwerbsobliegenheit verstößt, dem werden in -> Höhe des erzielbaren Einkommens fiktive Einkünfte zugerechnet (-> Erwerbsobliegenheiten & fiktive Einkünfte). Gründe, die gegen eine zumutbare -> Vollzeittätigkeit sprechen können, sind vielschichtig (-> Voraussetzungen für Erwerbsobliegenheit). Ein Grund gegen die Erwerbsobliegenheit ist die erwerbsmindernde Krankheit. Wie muss die Krankheit -> dargelegt und beweisen werden, damit sie als anerkannter Grund für eine fehlende oder verminderte Erwerbsobliegenheit ins Feld geführt werden kann? Dieses Thema greift der -> Wegweiser zur "Erwerbsobliegenheit bei Krankheit" auf.

    Autor: Dr. Schröck - Kanzlei für Familienrecht


    Wegweiser zur "Erwerbsobliegenheit bei Krankheit"


    I. Situation: Krankheit als Einwand gegen die Erwerbsobliegenheit

    Erwerbsobliegenheit oder erwerbsmindernde Krankheit?

    Dem von Krankheit Betroffenen obliegt es, seine gesundheitlichen Beeinträchtigungen im Einzelnen darzulegen und genau vorzutragen, welche Auswirkungen diese auf seine Erwerbsfähigkeit haben. Nur dann kommt eine Entlastung von der Erwerbsobliegenheit zum tragen (BGH FamRZ 2OO7,2OO). Derjenige, der sich auf krankheitsbedingt geminderte Erwerbsfähigkeit beruft, muss diese im Streifall auch beweisen. Wer sich auf seine Krankheit berufen möchte, um diese einer möglichen -> Erwerbsobliegenheit entgegenzuhalten, sollte sich bereits im Vorfeld eines -> Unterhaltsverfahrens stets um ein ausführliches medizinisches Privatgutachten bemühen und dieses im Prozess vorlegen. Denn die Erkrankungen, aus denen sich eine Erwerbsminderung ergeben sollen, müssen mit einem schriftlich Vortrag dem Gericht im Detail angegeben und dargelegt werden, dass die Krankheit kausal dafür sei, dass sich eine angemessene Erwerbstätigkeit nicht finden lässt und Bewerbungsbemühungen obsolet sind. Dafür muss im Schriftsatz für den Bestreitensfall ein Beweisantrag zur Einholung eines gerichtlich bestellten Sachverständigengutachtens enthalten sein. Einem solchen Beweisantrag braucht jedoch ein Gericht nicht zu folgen, wenn der dazu entsprechende Vortrag schon nicht hinreichend substantiiert, d.h. ausreichend -> dargelegt ist. Erst ein schlüssiger Vortrag von ernsthafter gesundheitlicher Einschränkungen, der die Kausalität zwischen Erkrankung und Erwerbsfähigkeit, veranlasst das Gericht zur die Einholung eines beantragten Sachverständigengutachtens (BVerfG, Beschluss vom 15.02. 2010 - 1 BvR 2236/09). Hierzu muss nicht exakt angeggeben werden zu welchem Grad eine Erwerbsminderung vorliegt. Ungefähre Schätzungen genügen.

    (Zitat, Rn 15) "Der Unterhalt begehrende Ehegatte muss (. ) im Einzelnen die Krankheiten, an denen er leidet, angeben und vortragen, inwiefern sich diese auf seine Erwerbsfähigkeit auswirken. Er darf sich nicht generell auf eine Erwerbsunfähigkeit im Sinne des § 1572 BGB berufen, sondern von ihm ist, insbesondere im Hinblick darauf, dass (. ) nur eine teilweise Erwerbsunfähigkeit vorliegen kann, zu verlangen, dass er Art und Umfang der gesundheitlichen Beeinträchtigungen oder Leiden darlegt (Senatsurteil vom 27. Juni 2001 - XII ZR 135/99 - FamRZ 2001, 1291, 1292)."

    (Zitat, Rn 13) "Wer sich gegenüber seiner Erwerbsobliegenheit auf eine krankheitsbedingte Einschränkung seiner Erwerbsfähigkeit berufen will, muss grundsätzlich Art und Umfang der behaupteten gesundheitlichen Beeinträchtigungen oder Leiden angeben, und er hat ferner darzulegen, inwieweit die behaupteten gesundheitlichen Störungen sich auf die Erwerbsfähigkeit auswirken (vgl. Senatsurteile vom 25. Oktober 2006 - XII ZR 190/03 - FamRZ 2007, 200, 201 f. und vom 27. Juni 2001 - XII ZR 135/99 - FamRZ 2001, 1291, 1292).

    (Zitat, Rn 14) "Inwieweit die tatsächliche nachhaltige Ausübung einer vollschichtigen Tätigkeit mit dem Vorbringen einer krankheitsbedingten Beeinträchtigung der Erwerbsfähigkeit in Einklang gebracht werden kann, ist eine der Beweiswürdigung vorzubehaltende Frage."


    ♦ Darlegungslast für zumutbare Heilbehandlung (Therapiemaßnahmen)

    liv 52 junior 100mg kautabletten montelukast nebenwirkungen

    Bearbeitung mit REIKI:

    Krankheit als Symbol oder Krankheit als Sprache der Seele von Ruediger Dahlke

    Krankheitsbilder Die Amyotrophe Lateralsklerose (ALS) ist eine chronisch-degenerative Erkrankung des zentralen Nervensystems und tritt im Vergleich zu anderen neurodegenerativen Krankheiten wie Parkinson selten auf.

    Pro Jahr erkranken nach Expertenschätzung etwa zwei von 100.000 Menschen an ALS. ALS ist durch den sichtbaren Schwund der Muskulatur zuerst an den Extremitäten, später auch im Gesicht und am übrigen Körper gekennzeichnet.

    • Sporadische Form: ALS hat keine erkennbare Ursache.
    • Familiäre Form: ALS wird durch eine Veränderung der Erbinformation auf einem Chromosom ausgelöst, die von den Eltern an ihre Kinder weitergegeben wird.
    • Endemische Form: Aus bisher ungeklärter Ursache tritt die ALS-Krankheit in manchen Gebieten deutlich häufiger auf.

    ALS ist eine Nervenkrankheit. Die Nervenzellen (Neuronen), die für die Übermittlung der Befehle an die Muskeln zuständig sind, arbeiten nicht mehr. So werden die Befehle aus Gehirn und Rückenmark immer schwächer und zudem später an die Muskeln weitergegeben. Auf die geistigen Fähigkeiten hat die Krankheit keine Auswirkungen.

    ALS ist die Abkürzung für Amyotrophe Lateralsklerose, eine neurologische Erkrankung, die sehr selten ist. Bei ALS sterben die motorischen Neuronen im Rückenmark, dem Hirnstamm und er motorischen Kortex des Gehirns ab. Deshalb erleidet der Körper einen starken Kraftverlust und eventuell Lähmung. Der Kraftverlust macht sich ganz besonders in den Beinen, den Armen und sogar den Muskeln, die man zum Sprechen und Schlucken bemerkbar. So wird Amyotrophe Lateralsklerose schließlich zum Tod durch Atemlähmung führen. Man nennt diese neurologische Krankheit manchmal auch Charcot-Krankheit. ALS ist eine Krankheit, die häufig vorkommt und in der Regel im späteren Leben beginnt. Meistens ist das Alter für den Beginn der Krankheit zwischen 40 und 60 Jahren. Jedes Jahr leidet eine wachsende Zahl von Menschen unter ALS. ALS ist eine kurze, aber schwere Krankheit und betrifft mehr Männer als Frauen.

    Die Ursache von ALS ist noch nicht vollständig bekannt. Ein Patient wird seinem Arzt relativ vage Symptome berichten. Die Beschwerden reichen von Unwohlsein bis zu Schwierigkeiten beim Schlucken. ALS kann eine erbliche Krankheit sein, aber das betrifft nur eine kleine Gruppe von Menschen, die ALS haben oder bekommen. Es gibt auch keine Medikamente, welche die Krankheit heilen können. Aber es gibt ein Medikament, welches den Krankheitsprozess etwas verlangsamen kann, und das ist das Medikament Riluzol, unter dem Markennamen Rilutek. Es kann die Krankheit bis zu 6 Monate verzögern. Der Name Amyotrophe Lateralsklerose kommt aus dem Griechischen und bedeutet im Grunde, Muskeln, die wenig oder keine Nahrung bekommen, weil das Rückenmark, wo sich die Nervenzellen befinden, keine Reize an die Muskeln sendet. Wenn diese Nervenzellen absterben, wird dies zu einer Verhärtung oder Narbenbildung führen.

    Die Diagnose von ALS Hausärzte und andere Ärzte haben eine schwierige Aufgabe, wenn es um die Feststellung der Diagnose von ALS geht. Das hat mit der Tatsache zu tun, dass die Krankheit selten ist und die Symptome der Patienten sind oft vage und werden von dem behandelnden Arzt nicht erkannt. Die Bestimmung der Diagnose ist schwierig für den Arzt, da es keine Diagnoseverfahren für ALS gibt. Zuerst ist es immer eine Vermutung, dass es diese Krankheit ist. Wenn der Hausarzt von den vagen Beschwerden die Krankheit nicht genau bestimmen kann, wird er eine Überweisung zu einem Neurologen ausstellen. Wenn der Neurologe ALS vermutet, wird der Patient direkt zu einem ALS-Center überwiesen. Die Spezialisten im ALS-Center werden eine Untersuchung machen, um andere Krankheiten auszuschließen, und wird dann eine ALS-Diagnose stellen. Sobald die Diagnose von den Fachleuten, die wegen der Schwere der Krankheit unbedingt nötig sind, als ALS bestätigt wird, wird die Diagnose dem Patienten mitgeteilt. Die durchschnittliche Lebenserwartung eines Patienten mit ALS liegt im Bereich von 3 bis 5 Jahren. 20% der Patienten leben länger als 5 Jahre und 5 % leben mehr als 20 Jahre nach den ersten Symptomen.

    Auszüge aus Büchern und Vorträgen
    von Dr. med. Michaela Glöckler

    Was ist Krankheit aus spiritueller Sicht?

    Was ist der tiefere Sinn von Krankheit im Hinblick auf die Entwicklung des Menschen?

    Das Geheimnis der menschlichen Entwicklung, das zugleich das Geheimnis von Gesundheit und Krankheit ist, lässt sich folgendermaßen zusammenfassen: Wenn sich jemand in Richtung Menschheitsziel entwickelt, wenn er an der Wahrheit und an der Welt interessiert ist und seine Freiheit und seinen Willen, so gut er kann, in den Dienst des Geistes stellt, kann er gar nicht verhindern, dass er immer gesünder wird. (vgl. Gesundheit: Gesundheit und Denken). Das gilt auch dann, wenn jemand aus karmischen Gründen diese oder jene Krankheit durchzumachen hat. Mit der oben genannten Haltung lässt sich alles besser verkraften.

    Nachdem Rudolf Steiner einmal über diese Zusammenhänge einen Vortag gehalten hatte, sprach ihn im Abschluss jemand darauf an, dass so viele Anthroposophen krank sind. Daraufhin antwortete er: „Ich möchte Ihnen nicht erzählen, wie krank sie wären, wenn sie die Anthroposophie nicht kennen gelernt hätten.“ Humor ist natürlich auch gesund.

    Wenn bestimmte Ziele gar nicht angestrebt und deshalb auch nicht erreicht werden, wenn es so ist, wie es in der Apokalypse heißt, dass die Menschen sich nicht ändern, dass sie in ihrer Entwicklung stehen bleiben, dass sie nichts tun und nicht vom Fleck kommen, wenn es irgendwann solche Formen annimmt, dass alle Güter der Welt im Dienste des Ego stehen, dann werden alle möglichen Leiden und Schmerzen die Folge sein (vgl. Krankheit: Folgen des Fehlens spiritueller Werte).

    Wir sind der alten Gesetzmäßigkeit, die ausführlich erklärt wird im Buch der Apokalypse, noch nicht zur Gänze entwachsen. Diese Gesetze bilden immer noch den Grundstock unserer Natur. Es wird auch deutlich gemacht, dass jeder selbst den Schlüssel in der Hand hat, um dem entgegenzuwirken.

    Rudolf Steiner beschreibt in „Wie erlangt man Erkenntnisse der höheren Welten?“ 1 in Gedankenform, was er uns in der Apokalypse in Bildform vor Augen führt: Wie der Mensch sich zuerst als individuelles Wesen entwickelt, um schließlich den Weg zum Gral zu finden und ein soziales „menschheitliches“ Wesen zu werden.

    Wenn wir die Skizze vom Merkurstab betrachten, haben wir hier im oberen Teil das bewusste Leben und im unteren Bereich das unbewusste Leben. Die merkurielle Dynamik führt die die Kräfte des Oberen – das außerkörperliche Erkenntnisleben – in die Wirkbereiche des Unteren – in die unbewussten Lebenswelten des Stoffwechsels – über und umgekehrt. Das ist zugleich die Schwellendramatik zwischen der sinnlichen und der über-sinnlichen Welt. Sie zeigt, wie Krankheit dadurch entstehen kann, dass man an dieser Grenze, der Schwelle zur geistigen Welt, körperlich, seelisch oder geistig – wodurch auch immer verursacht – die rechte Orientierung verliert.

    Wenn ein Mensch nun eine bestimmte Fähigkeit erwerben möchte, z.B. inneren Frieden, Ruhe, und er die Bedingungen nicht vorfindet, um diese Qualität zu entwickeln, kann es zu einer Erkrankung kommen, die Frieden am falschen Platz erzeugt. Denn die Kräfte, die inneren Frieden herstellen können, sind potentiell immer vorhanden. Wenn sie aber auf der seelisch-geistigen Ebene nicht genützt werden, wo sie gesundheitsfördernd wirken würden, sinken diese ungenützten Kräfte Nacht für Nacht tiefer in das unbewusste Körperleben und der Betreffende entwickelt Rheuma. Das nur als Beispiel.

    Es kostet unseren Körper unglaublich viel Kraft, eine Krankheit hervorzubringen. Ein normaler Organismus möchte gesund sein. Zusätzliche Kräfte aus dem Seelisch-Geistigen sind nötig, um diesen Extraaufwand krank zu werden zu bewerkstelligen. Heilung bedeutet nun, diese Kräfte wieder an ihren richtigen Platz zu erheben und Kräfte im Körper aufzurufen, die sie dorthin bringen. Daraus lässt sich eine „spirituelle Pathogenese“, eine Aufklärung über die Herkunft von Leiden ableiten. Wir können jede Station dieses Weges anschauen und begreifen, was geschieht, wenn die Erkenntniskräfte, anstatt im Geistigen zu tätig zu sein, im Körperlichen zu wirken beginnen und damit eine Krankheit hervorrufen.

    Entscheidend dabei ist jedoch, dass Krankheit in diesem Kontext nicht als Makel, Fehler oder Irrtum gebrandmarkt wird. Vielmehr ist Sinn der Krankheit ihr Auftreten selbst, weil in ihr die – wenn auch schmerzhafte – Korrektur, und damit auch die Heilung, veranlagt ist. Krankheit erscheint in diesem spirituellen Kontext als ein Gutes, das sich im Körper oder in der Seele des Menschen einen Ort schafft, an dem sich der notwendige Schicksal-sausgleich vollziehen kann.

    Vgl. mit einer Zusammenstellung von Vorträgen über „Die sieben Siegel der Apokalypse“ gehalten 2007

    1. Rudolf Steiner, Wie erlangt man Erkenntnisse der Höheren Welten?, GA 10.

    Da steht deinem Freund ein echter Leidensweg bevor.

    ALS ist erblich ich habe es von meinem Vater wurde festgestellt im RKU-ULM.
    Dort ist die Neurologie sehr gut, bei mir keine kraft mehr im linken arm, der rechte geht noch,auch bin ich schmerzfrei kann reden schlucken, essen

    Neues Thema in der Kategorie Amyotrophe Lateralsklerose erstellen